January 17, 2022

NLGN1 Rabbit Polyclonal Antibody

NLGN1 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

NLGN1 Polyclonal Antibody

ES9911-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NLGN1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Rat Neuroligin 1 (NLGN1) ELISA Kit

DLR-NLGN1-Ra-48T 48T
EUR 549
  • Should the Rat Neuroligin 1 (NLGN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Neuroligin 1 (NLGN1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Neuroligin 1 (NLGN1) ELISA Kit

DLR-NLGN1-Ra-96T 96T
EUR 718
  • Should the Rat Neuroligin 1 (NLGN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Neuroligin 1 (NLGN1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Neuroligin 1 (NLGN1) ELISA Kit

RDR-NLGN1-Ra-48Tests 48 Tests
EUR 583

Rat Neuroligin 1 (NLGN1) ELISA Kit

RDR-NLGN1-Ra-96Tests 96 Tests
EUR 811

Rat Neuroligin 1 (NLGN1) ELISA Kit

RD-NLGN1-Ra-48Tests 48 Tests
EUR 557

Rat Neuroligin 1 (NLGN1) ELISA Kit

RD-NLGN1-Ra-96Tests 96 Tests
EUR 775

NLGN1 Rabbit pAb

A16105-100ul 100 ul
EUR 308

NLGN1 Rabbit pAb

A16105-200ul 200 ul
EUR 459

NLGN1 Rabbit pAb

A16105-20ul 20 ul
EUR 183

NLGN1 Rabbit pAb

A16105-50ul 50 ul
EUR 223

NLGN1 Antibody

36650-100ul 100ul
EUR 252

NLGN1 Antibody

46627-100ul 100ul
EUR 252

NLGN1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NLGN1. Recognizes NLGN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

NLGN1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NLGN1. Recognizes NLGN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

NLGN1 Antibody

DF9690 200ul
EUR 304
Description: NLGN1 Antibody detects endogenous levels of total NLGN1.

NLGN1 Antibody

ABD9690 100 ug
EUR 438

NLGN1 Conjugated Antibody

C36650 100ul
EUR 397

Anti-NLGN1 antibody

STJ118558 100 µl
EUR 277

Anti-NLGN1 antibody

STJ191069 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NLGN1

Nlgn1/ Rat Nlgn1 ELISA Kit

ELI-20702r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NLGN1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NLGN1. Recognizes NLGN1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NLGN1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NLGN1. Recognizes NLGN1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NLGN1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NLGN1. Recognizes NLGN1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Neuroligin 1 (NLGN1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Neuroligin 1 (Nlgn1) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Neuroligin 1 (NLGN1) Antibody

abx122672-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Neuroligin 1 (Nlgn1) Antibody

abx433026-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

Neuroligin 1 (Nlgn1) Antibody

abx445072-100ug 100 ug
EUR 523
  • Shipped within 5-12 working days.

Neuroligin 1 (NLGN1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NLGN1 Blocking Peptide

DF9690-BP 1mg
EUR 195

NLGN1 cloning plasmid

CSB-CL839786HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2472
  • Sequence: atggcactgcccagatgcacgtggccaaattatgtttggagagcagtgatggcatgcttggtacaccggggattgggtgccccattgactctctgtatgttgggatgtttgcttcaggctggccatgtgctatcacaaaaattggatgatgtggacccactggtggctaccaact
  • Show more
Description: A cloning plasmid for the NLGN1 gene.

anti-NLGN1 + NLGN2

YF-PA17644 50 ug
EUR 363
Description: Mouse polyclonal to NLGN1 + NLGN2

anti-NLGN1 + NLGN2

YF-PA25805 50 ul
EUR 334
Description: Mouse polyclonal to NLGN1 + NLGN2

Neuroligin 1 (NLGN1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuroligin 1 (NLGN1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuroligin 1 (NLGN1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuroligin 1 (Nlgn1) Antibody (ALP)

abx442469-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

NLGN1 Rabbit Polyclonal Antibody