January 17, 2022

CCL28 Rabbit Polyclonal Antibody

CCL28 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

CCL28 Polyclonal Antibody

ES10268-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CCL28 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

CCL28 Rabbit pAb

A2596-100ul 100 ul
EUR 308

CCL28 Rabbit pAb

A2596-200ul 200 ul
EUR 459

CCL28 Rabbit pAb

A2596-20ul 20 ul
EUR 183

CCL28 Rabbit pAb

A2596-50ul 50 ul
EUR 223

CCL28 antibody

70R-16226 50 ul
EUR 435
Description: Rabbit polyclonal CCL28 antibody

CCL28 Antibody

32743-100ul 100ul
EUR 252

CCL28 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CCL28. Recognizes CCL28 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CCL28 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CCL28. Recognizes CCL28 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

CCL28 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CCL28. Recognizes CCL28 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

CCL28 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CCL28. Recognizes CCL28 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CCL28 Antibody

DF7045 200ul
EUR 304
Description: CCL28 Antibody detects endogenous levels of total CCL28.

CCL28 Antibody

ABD7045 100 ug
EUR 438


E21-095 10ug
EUR 343

CCL28 Conjugated Antibody

C32743 100ul
EUR 397

anti- CCL28 antibody

FNab01383 100µg
EUR 505.25
  • Immunogen: chemokine(C-C motif) ligand 28
  • Uniprot ID: Q9NRJ3
  • Gene ID: 56477
  • Research Area: Immunology
Description: Antibody raised against CCL28

Anti-CCL28 antibody

PAab01383 100 ug
EUR 355

Anti-CCL28 antibody

STJ22934 100 µl
EUR 277
Description: This antimicrobial gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for resting CD4 or CD8 T cells and eosinophils. The product of this gene binds to chemokine receptors CCR3 and CCR10. This chemokine may play a role in the physiology of extracutaneous epithelial tissues, including diverse mucosal organs. Multiple transcript variants encoding two different isoforms have been found for this gene.

Anti-CCL28 antibody

STJ191426 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CCL28


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA20001 50 ul
EUR 363
Description: Mouse polyclonal to CCL28


YF-PA20002 50 ug
EUR 363
Description: Mouse polyclonal to CCL28

CCL28 Blocking Peptide

DF7045-BP 1mg
EUR 195

CCL28 cloning plasmid

CSB-CL868302HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 384
  • Sequence: atgcagcagagaggactcgccatcgtggccttggctgtctgtgcggccctacatgcctcagaagccatacttcccattgcctccagctgttgcacggaggtttcacatcatatttccagaaggctcctggaaagagtgaatatgtgtcgcatccagagagctgatggggattgtga
  • Show more
Description: A cloning plasmid for the CCL28 gene.

MEC/CCL28, Human

HY-P7250 10ug
EUR 268

MEC/CCL28, Mouse

HY-P7251 50mg
EUR 533

MEC/CCL28, Rat

HY-P7252 10mg
EUR 268

MEC, CCL28, human

RC315-39 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

MEC, CCL28, rat

RC355-39 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

MEC/CCL28, human recombinant

EUR 207

MEC/CCL28, human recombinant

EUR 675

MEC/CCL28, murine recombinant

EUR 207

MEC/CCL28, murine recombinant

EUR 675

CCL28 protein (His tag)

80R-1194 100 ug
EUR 397
Description: Purified recombinant Human CCL28 protein

Human CCL28 ELISA Kit

ELA-E1573h 96 Tests
EUR 824


ELI-05166d 96 Tests
EUR 928


EF000436 96 Tests
EUR 689

Mouse CCL28 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CCL28 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CCL28 ELISA Kit

LF-EK50878 1×96T
EUR 648

MEC, CCL28, murine (mouse)

RC335-39 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

C-C Motif Chemokine 28 (CCL28) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

C-C Motif Chemokine 28 (CCL28) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

C-C Motif Chemokine 28 (CCL28) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

C-C Motif Chemokine 28 (CCL28) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

C-C Motif Chemokine 28 (CCL28) Antibody

abx231383-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

C-C Motif Chemokine 28 (CCL28) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mouse CCL28 Detection Assay Kit

6724 1 kit
EUR 483.55
Description: Mouse CCL28 Detection Assay Kit

ELISA kit for Human CCL28

EK5277 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human CCL28 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Mouse CCL28

EK5278 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse CCL28 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human CCL28 PicoKine ELISA Kit

EK0690 96 wells
EUR 425
Description: For quantitative detection of human CCL28 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Mouse CCL28 PicoKine ELISA Kit

EK0691 96 wells
EUR 425
Description: For quantitative detection of mouse CCL28 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Ccl28 ORF Vector (Rat) (pORF)

ORF064555 1.0 ug DNA
EUR 506

CCL28 ORF Vector (Human) (pORF)

ORF002044 1.0 ug DNA
EUR 95

CCL28 Rabbit Polyclonal Antibody