October 23, 2021

RAB1A Rabbit Polyclonal Antibody

RAB1A Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
DLR-RAB1A-Hu-96T 96T
EUR 673
  • Should the Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in samples from tissue homogenates or other biological fluids.
Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
RD-RAB1A-Hu-48Tests 48 Tests
EUR 521
Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
RD-RAB1A-Hu-96Tests 96 Tests
EUR 723
Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
RDR-RAB1A-Hu-48Tests 48 Tests
EUR 544
Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
RDR-RAB1A-Hu-96Tests 96 Tests
EUR 756
RAB1A Polyclonal Antibody
ES10115-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RAB1A from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
RAB1A Polyclonal Antibody
ES10115-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RAB1A from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
RAB1A Polyclonal Antibody
ABP60061-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human RAB1A protein at amino acid sequence of 50-130
  • Applications tips:
Description: A polyclonal antibody for detection of RAB1A from Human, Mouse, Rat. This RAB1A antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB1A protein at amino acid sequence of 50-130
RAB1A Polyclonal Antibody
ABP60061-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RAB1A protein at amino acid sequence of 50-130
  • Applications tips:
Description: A polyclonal antibody for detection of RAB1A from Human, Mouse, Rat. This RAB1A antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB1A protein at amino acid sequence of 50-130
RAB1A Polyclonal Antibody
ABP60061-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RAB1A protein at amino acid sequence of 50-130
  • Applications tips:
Description: A polyclonal antibody for detection of RAB1A from Human, Mouse, Rat. This RAB1A antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB1A protein at amino acid sequence of 50-130
RAB1A Polyclonal Antibody
A52624 100 µg
EUR 570.55
Description: The best epigenetics products
RAB1A Polyclonal Antibody
30025-100ul 100ul
EUR 252
RAB1A Polyclonal Antibody
30025-50ul 50ul
EUR 187
RAB1A Polyclonal Antibody
28668-100ul 100ul
EUR 252
RAB1A Polyclonal Antibody
28668-50ul 50ul
EUR 187
RAB1A Rabbit pAb
A17364-100ul 100 ul
EUR 308
RAB1A Rabbit pAb
A17364-200ul 200 ul
EUR 459
RAB1A Rabbit pAb
A17364-20ul 20 ul
EUR 183
RAB1A Rabbit pAb
A17364-50ul 50 ul
EUR 223
RAB1A Rabbit pAb
A14663-100ul 100 ul
EUR 308
RAB1A Rabbit pAb
A14663-200ul 200 ul
EUR 459
RAB1A Rabbit pAb
A14663-20ul 20 ul
EUR 183
RAB1A Rabbit pAb
A14663-50ul 50 ul
EUR 223
RAB1A Polyclonal Conjugated Antibody
C30025 100ul
EUR 397
RAB1A Polyclonal Conjugated Antibody
C28668 100ul
EUR 397
RAB1A, Member RAS Oncogene Family (RAB1A) Polyclonal Antibody (Human)
4-PAJ783Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RAB1A (Ser2~Cys205)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human RAB1A, Member RAS Oncogene Family (RAB1A)
RAB1A Antibody
ABD9817 100 ug
EUR 438
RAB1A antibody
70R-2860 50 ug
EUR 467
Description: Rabbit polyclonal RAB1A antibody raised against the middle region of RAB1A
RAB1A Antibody
39737-100ul 100ul
EUR 390
RAB1A antibody
70R-19689 50 ul
EUR 435
Description: Rabbit polyclonal RAB1A antibody
Rab1A antibody
70R-15148 100 ug
EUR 327
Description: Rabbit polyclonal Rab1A antibody
RAB1A Antibody
DF9817 200ul
EUR 304
Description: RAB1A Antibody detects endogenous levels of total RAB1A.
RAB1A Antibody
1-CSB-PA00335A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB1A. Recognizes RAB1A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000
RAB1A Antibody
1-CSB-PA019167GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RAB1A. Recognizes RAB1A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
Polyclonal RAB1A Antibody (C-Terminus)
AMM07451G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human RAB1A (C-Terminus). This antibody is tested and proven to work in the following applications:
Polyclonal RAB1A antibody - middle region
AMM07452G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAB1A - middle region. This antibody is tested and proven to work in the following applications:
RAB1A Polyclonal Antibody, Biotin Conjugated
A52621 100 µg
EUR 570.55
Description: Ask the seller for details
RAB1A Polyclonal Antibody, FITC Conjugated
A52622 100 µg
EUR 570.55
Description: The best epigenetics products
RAB1A Polyclonal Antibody, HRP Conjugated
A52623 100 µg
EUR 570.55
Description: kits suitable for this type of research
RAB1A, Member RAS Oncogene Family (RAB1A) Polyclonal Antibody (Human), APC
4-PAJ783Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RAB1A (Ser2~Cys205)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human RAB1A, Member RAS Oncogene Family (RAB1A). This antibody is labeled with APC.
RAB1A, Member RAS Oncogene Family (RAB1A) Polyclonal Antibody (Human), Biotinylated
4-PAJ783Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RAB1A (Ser2~Cys205)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human RAB1A, Member RAS Oncogene Family (RAB1A). This antibody is labeled with Biotin.
RAB1A, Member RAS Oncogene Family (RAB1A) Polyclonal Antibody (Human), Cy3
4-PAJ783Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RAB1A (Ser2~Cys205)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human RAB1A, Member RAS Oncogene Family (RAB1A). This antibody is labeled with Cy3.
RAB1A, Member RAS Oncogene Family (RAB1A) Polyclonal Antibody (Human), FITC
4-PAJ783Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RAB1A (Ser2~Cys205)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human RAB1A, Member RAS Oncogene Family (RAB1A). This antibody is labeled with FITC.
RAB1A, Member RAS Oncogene Family (RAB1A) Polyclonal Antibody (Human), HRP
4-PAJ783Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RAB1A (Ser2~Cys205)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human RAB1A, Member RAS Oncogene Family (RAB1A). This antibody is labeled with HRP.
RAB1A, Member RAS Oncogene Family (RAB1A) Polyclonal Antibody (Human), PE
4-PAJ783Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RAB1A (Ser2~Cys205)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human RAB1A, Member RAS Oncogene Family (RAB1A). This antibody is labeled with PE.
RAB1A, Member RAS Oncogene Family (RAB1A) Polyclonal Antibody (Human), APC-Cy7
4-PAJ783Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RAB1A (Ser2~Cys205)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human RAB1A, Member RAS Oncogene Family (RAB1A). This antibody is labeled with APC-Cy7.
RAB1A, Member RAS Oncogene Family (RAB1A) Antibody
20-abx131530
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
RAB1A, Member RAS Oncogene Family (RAB1A) Antibody
abx036061-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
RAB1A, Member RAS Oncogene Family (RAB1A) Antibody
20-abx174325
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
RAB1A, Member RAS Oncogene Family (RAB1A) Antibody
abx218111-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
RAB1A, Member RAS Oncogene Family (RAB1A) Antibody
abx237000-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
anti- RAB1A antibody
FNab07000 100µg
EUR 505.25
  • Immunogen: RAB1A, member RAS oncogene family
  • Uniprot ID: P62820
  • Gene ID: 5861
  • Research Area: Signal Transduction
Description: Antibody raised against RAB1A
Rab1A antibody (HRP)
60R-1281 100 ug
EUR 327
Description: Rabbit polyclonal Rab1A antibody (HRP)
Rab1A antibody (FITC)
60R-1282 100 ug
EUR 327
Description: Rabbit polyclonal Rab1A antibody (FITC)
Rab1A antibody (biotin)
60R-1283 100 ug
EUR 327
Description: Rabbit polyclonal Rab1A antibody (biotin)
Anti-RAB1A antibody
PAab07000 100 ug
EUR 355
Anti-RAB1A antibody
STJ119490 100 µl
EUR 277
Description: This gene encodes a member of the Ras superfamily of GTPases. Members of the gene family cycle between inactive GDP-bound and active GTP-bound forms. This small GTPase controls vesicle traffic from the endoplasmic reticulum to the Golgi apparatus. Multiple alternatively spliced transcript variants have been identified for this gene which encode different protein isoforms.
Anti-RAB1A antibody
STJ116867 100 µl
EUR 277
Description: This gene encodes a member of the Ras superfamily of GTPases. Members of the gene family cycle between inactive GDP-bound and active GTP-bound forms. This small GTPase controls vesicle traffic from the endoplasmic reticulum to the Golgi apparatus. Multiple alternatively spliced transcript variants have been identified for this gene which encode different protein isoforms.
Anti-RAB1A antibody
STJ191273 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RAB1A
Rab1A/ Rat Rab1A ELISA Kit
ELI-30459r 96 Tests
EUR 886
RAB1A, Member RAS Oncogene Family (RAB1A) Antibody Pair
abx117425-1pair5x96wellplates 1 pair (5x96 well plates)
EUR 1010
  • Shipped within 5-10 working days.
RAB1A siRNA
20-abx904415
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RAB1A siRNA
20-abx930611
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RAB1A siRNA
20-abx930612
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RAB1A Antibody, HRP conjugated
1-CSB-PA00335B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB1A. Recognizes RAB1A from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
RAB1A Antibody, FITC conjugated
1-CSB-PA00335C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB1A. Recognizes RAB1A from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
RAB1A Antibody, Biotin conjugated
1-CSB-PA00335D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB1A. Recognizes RAB1A from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Recombinant RAB1A, Member RAS Oncogene Family (RAB1A)
4-RPJ783Hu01
  • EUR 315.04
  • EUR 187.00
  • EUR 906.40
  • EUR 368.80
  • EUR 637.60
  • EUR 274.00
  • EUR 2116.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P62820
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 26.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human RAB1A, Member RAS Oncogene Family expressed in: E.coli
Human RAB1A, Member RAS Oncogene Family (RAB1A) Protein
20-abx650772
  • EUR 453.00
  • EUR 230.00
  • EUR 1233.00
  • EUR 523.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
RAB1A cloning plasmid
CSB-CL019167HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 618
  • Sequence: atgtccagcatgaatcccgaatatgattatttattcaagttacttctgattggcgactcaggggttggaaagtcttgccttcttcttaggtttgcagatgatacatatacagaaagctacatcagcacaattggtgtggatttcaaaataagaactatagagttagacgggaaaac
  • Show more
Description: A cloning plasmid for the RAB1A gene.
RAB1A Blocking Peptide
33R-1303 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UBE3A antibody, catalog no. 70R-5247
RAB1A Blocking Peptide
DF9817-BP 1mg
EUR 195
pCMV-SPORT6-RAB1A
PVT18186 2 ug
EUR 231

RAB1A Rabbit Polyclonal Antibody