September 27, 2021

SNPH Rabbit Polyclonal Antibody

SNPH Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

SNPH Polyclonal Antibody

ABP60452-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human SNPH protein
  • Applications tips:
Description: A polyclonal antibody for detection of SNPH from Human, Mouse, Rat. This SNPH antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SNPH protein

SNPH Polyclonal Antibody

ABP60452-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human SNPH protein
  • Applications tips:
Description: A polyclonal antibody for detection of SNPH from Human, Mouse, Rat. This SNPH antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SNPH protein

SNPH Polyclonal Antibody

ES10340-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against SNPH from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

SNPH Polyclonal Antibody

ES10340-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SNPH from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

SNPH Rabbit pAb

A12300-100ul 100 ul
EUR 308

SNPH Rabbit pAb

A12300-200ul 200 ul
EUR 459

SNPH Rabbit pAb

A12300-20ul 20 ul
EUR 183

SNPH Rabbit pAb

A12300-50ul 50 ul
EUR 223

SNPH Polyclonal Conjugated Antibody

C27674 100ul
EUR 397

SNPH antibody

70R-20426 50 ul
EUR 435
Description: Rabbit polyclonal SNPH antibody

SNPH Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SNPH. Recognizes SNPH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

SNPH Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SNPH. Recognizes SNPH from Human. This antibody is Unconjugated. Tested in the following application: ELISA

Polyclonal SNPH Antibody (N-Terminus)

APR13440G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SNPH (N-Terminus). This antibody is tested and proven to work in the following applications:

SNPH Polyclonal Antibody, Biotin Conjugated

A61071 100 µg
EUR 570.55
Description: The best epigenetics products

SNPH Polyclonal Antibody, FITC Conjugated

A61072 100 µg
EUR 570.55
Description: kits suitable for this type of research

SNPH Polyclonal Antibody, HRP Conjugated

A61073 100 µg
EUR 570.55
Description: fast delivery possible

Snph/ Rat Snph ELISA Kit

ELI-29796r 96 Tests
EUR 886

Syntaphilin (SNPH) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Syntaphilin (SNPH) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Syntaphilin (SNPH) Antibody

abx238443-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Syntaphilin (SNPH) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-SNPH antibody

STJ114188 100 µl
EUR 277
Description: Syntaxin-1, synaptobrevin/VAMP, and SNAP25 interact to form the SNARE complex, which is required for synaptic vesicle docking and fusion. The protein encoded by this gene is membrane-associated and inhibits SNARE complex formation by binding free syntaxin-1. Expression of this gene appears to be brain-specific. Alternative splicing results in multiple transcript variants encoding different isoforms.

Anti-SNPH antibody

STJ191498 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SNPH


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA16505 50 ug
EUR 363
Description: Mouse polyclonal to SNPH

SNPH Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SNPH. Recognizes SNPH from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SNPH Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SNPH. Recognizes SNPH from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SNPH Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SNPH. Recognizes SNPH from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Syntaphilin (SNPH) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Syntaphilin (SNPH) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Syntaphilin (SNPH) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human Syntaphilin (SNPH)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 62 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Syntaphilin(SNPH),partial expressed in E.coli

Syntaphilin (SNPH) Protein

  • EUR 230.00
  • EUR 2332.00
  • EUR 328.00
  • 10 ug
  • 1 mg
  • 50 ug
  • Shipped within 5-10 working days.

SNPH cloning plasmid

CSB-CL022317HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1485
  • Sequence: atggccatgtccctgccaggaagtagacggacctctgctggatcacgcaggcgcacctctccacctgtgagcgtgcgggatgcctacggcacctcttcgctcagcagcagcagcaattctggctcctacaagggcagtgacagcagtcccacgccaaggcgctccatgaaataca
  • Show more
Description: A cloning plasmid for the SNPH gene.

Anti-SNPH (3B6)

YF-MA16997 100 ug
EUR 363
Description: Mouse monoclonal to SNPH

Rat SNPH shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SNPH shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse SNPH shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SNPH Recombinant Protein (Rat)

RP230270 100 ug Ask for price

SNPH Recombinant Protein (Human)

RP029527 100 ug Ask for price

SNPH Recombinant Protein (Mouse)

RP174206 100 ug Ask for price

Mouse Syntaphilin, Snph ELISA KIT

ELI-13921m 96 Tests
EUR 865

Human Syntaphilin (SNPH) ELISA Kit

  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human Syntaphilin (SNPH) ELISA Kit

abx383604-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Syntaphilin, SNPH ELISA KIT

ELI-39444h 96 Tests
EUR 824

Snph ORF Vector (Rat) (pORF)

ORF076758 1.0 ug DNA
EUR 506

SNPH ORF Vector (Human) (pORF)

ORF009843 1.0 ug DNA
EUR 95

Snph ORF Vector (Mouse) (pORF)

ORF058070 1.0 ug DNA
EUR 506

SNPH Syntaphilin Human Recombinant Protein

PROTO15079 Regular: 50ug
EUR 317
Description: SNPH Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 444 amino acids (1-424) and having a molecular mass of 48.2 kDa.;The SNPH is fused to 20 amino acid His-Tag at N-terminus and purified by standard chromatography techniques.

Human Syntaphilin(SNPH)ELISA Kit

QY-E01676 96T
EUR 361

Snph sgRNA CRISPR Lentivector set (Rat)

K6265401 3 x 1.0 ug
EUR 339

Snph sgRNA CRISPR Lentivector set (Mouse)

K4402701 3 x 1.0 ug
EUR 339

SNPH sgRNA CRISPR Lentivector set (Human)

K2249801 3 x 1.0 ug
EUR 339

Snph sgRNA CRISPR Lentivector (Rat) (Target 1)

K6265402 1.0 ug DNA
EUR 154

Snph sgRNA CRISPR Lentivector (Rat) (Target 2)

K6265403 1.0 ug DNA
EUR 154

Snph sgRNA CRISPR Lentivector (Rat) (Target 3)

K6265404 1.0 ug DNA
EUR 154

Snph sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4402702 1.0 ug DNA
EUR 154

Snph sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4402703 1.0 ug DNA
EUR 154

Snph sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4402704 1.0 ug DNA
EUR 154

SNPH sgRNA CRISPR Lentivector (Human) (Target 1)

K2249802 1.0 ug DNA
EUR 154

SNPH sgRNA CRISPR Lentivector (Human) (Target 2)

K2249803 1.0 ug DNA
EUR 154

SNPH sgRNA CRISPR Lentivector (Human) (Target 3)

K2249804 1.0 ug DNA
EUR 154

SNPH Protein Vector (Rat) (pPB-C-His)

PV307030 500 ng
EUR 603

SNPH Protein Vector (Rat) (pPB-N-His)

PV307031 500 ng
EUR 603

SNPH Protein Vector (Rat) (pPM-C-HA)

PV307032 500 ng
EUR 603

SNPH Protein Vector (Rat) (pPM-C-His)

PV307033 500 ng
EUR 603

SNPH Protein Vector (Human) (pPB-C-His)

PV039369 500 ng
EUR 329

SNPH Protein Vector (Human) (pPB-N-His)

PV039370 500 ng
EUR 329

SNPH Protein Vector (Human) (pPM-C-HA)

PV039371 500 ng
EUR 329

SNPH Protein Vector (Human) (pPM-C-His)

PV039372 500 ng
EUR 329

SNPH Protein Vector (Mouse) (pPB-C-His)

PV232278 500 ng
EUR 603

SNPH Protein Vector (Mouse) (pPB-N-His)

PV232279 500 ng
EUR 603

SNPH Protein Vector (Mouse) (pPM-C-HA)

PV232280 500 ng
EUR 603

SNPH Protein Vector (Mouse) (pPM-C-His)

PV232281 500 ng
EUR 603

Snph 3'UTR Luciferase Stable Cell Line

TU119388 1.0 ml Ask for price

Snph 3'UTR GFP Stable Cell Line

TU169388 1.0 ml Ask for price

Snph 3'UTR Luciferase Stable Cell Line

TU220895 1.0 ml Ask for price

Snph 3'UTR GFP Stable Cell Line

TU270895 1.0 ml Ask for price

SNPH 3'UTR GFP Stable Cell Line

TU074226 1.0 ml
EUR 2333

SNPH 3'UTR Luciferase Stable Cell Line

TU024226 1.0 ml
EUR 2333

SNPH Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV697849 1.0 ug DNA
EUR 682

SNPH Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV697853 1.0 ug DNA
EUR 682

SNPH Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV697854 1.0 ug DNA
EUR 682

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

SNPH Rabbit Polyclonal Antibody