PTPRD Rabbit Polyclonal Antibody
To Order Contact us: [email protected]
 PTPRD Polyclonal Antibody |
|
31600-100ul |
SAB |
100ul |
EUR 252 |
PTPRD Polyclonal Antibody |
|
31600-50ul |
SAB |
50ul |
EUR 187 |
 Polyclonal PTPRD Antibody |
|
APR13026G |
Leading Biology |
0.1 mg |
EUR 659 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PTPRD . This antibody is tested and proven to work in the following applications: |
PTPRD Polyclonal Antibody |
|
ABP60036-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human PTPRD protein at amino acid sequence of 510-590
- Applications tips:
|
|
Description: A polyclonal antibody for detection of PTPRD from Human, Mouse. This PTPRD antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTPRD protein at amino acid sequence of 510-590 |
PTPRD Polyclonal Antibody |
|
ABP60036-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human PTPRD protein at amino acid sequence of 510-590
- Applications tips:
|
|
Description: A polyclonal antibody for detection of PTPRD from Human, Mouse. This PTPRD antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTPRD protein at amino acid sequence of 510-590 |
PTPRD Polyclonal Antibody |
|
ABP60036-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PTPRD protein at amino acid sequence of 510-590
- Applications tips:
|
|
Description: A polyclonal antibody for detection of PTPRD from Human, Mouse. This PTPRD antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTPRD protein at amino acid sequence of 510-590 |
PTPRD Polyclonal Antibody |
|
ES10140-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against PTPRD from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PTPRD Polyclonal Antibody |
|
ES10140-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against PTPRD from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 PTPRD Polyclonal Conjugated Antibody |
|
C31600 |
SAB |
100ul |
EUR 397 |
PTPRD Polyclonal Conjugated Antibody |
|
C28823 |
SAB |
100ul |
EUR 397 |
PTPRD Polyclonal Conjugated Antibody |
|
C29396 |
SAB |
100ul |
EUR 397 |
 PTPRD Rabbit pAb |
|
A15713-100ul |
Abclonal |
100 ul |
EUR 308 |
PTPRD Rabbit pAb |
|
A15713-200ul |
Abclonal |
200 ul |
EUR 459 |
PTPRD Rabbit pAb |
|
A15713-20ul |
Abclonal |
20 ul |
EUR 183 |
PTPRD Rabbit pAb |
|
A15713-50ul |
Abclonal |
50 ul |
EUR 223 |
PTPRD Rabbit pAb |
|
A8559-100ul |
Abclonal |
100 ul |
EUR 308 |
PTPRD Rabbit pAb |
|
A8559-200ul |
Abclonal |
200 ul |
EUR 459 |
PTPRD Rabbit pAb |
|
A8559-20ul |
Abclonal |
20 ul |
EUR 183 |
PTPRD Rabbit pAb |
|
A8559-50ul |
Abclonal |
50 ul |
EUR 223 |
PTPRD Rabbit pAb |
|
A15089-100ul |
Abclonal |
100 ul |
EUR 308 |
PTPRD Rabbit pAb |
|
A15089-200ul |
Abclonal |
200 ul |
EUR 459 |
PTPRD Rabbit pAb |
|
A15089-20ul |
Abclonal |
20 ul |
EUR 183 |
PTPRD Rabbit pAb |
|
A15089-50ul |
Abclonal |
50 ul |
EUR 223 |
 PTPRD Antibody |
|
25495-100ul |
SAB |
100ul |
EUR 390 |
 Anti-PTPRD antibody |
|
STJ111295 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular region, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region of this protein is composed of three Ig-like and eight fibronectin type III-like domains. Studies of the similar genes in chicken and fly suggest the role of this PTP is in promoting neurite growth, and regulating neurons axon guidance. Multiple alternatively spliced transcript variants of this gene have been reported. A related pseudogene has been identified on chromosome 5. |
Anti-PTPRD antibody |
|
STJ117283 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular region, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region of this protein is composed of three Ig-like and eight fibronectin type III-like domains. Studies of the similar genes in chicken and fly suggest the role of this PTP is in promoting neurite growth, and regulating neurons axon guidance. Multiple alternatively spliced transcript variants of this gene have been reported. A related pseudogene has been identified on chromosome 5. |
Anti-PTPRD antibody |
|
STJ191298 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to PTPRD |
 PTPRD siRNA |
|
20-abx930399 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PTPRD siRNA |
|
20-abx930400 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 PTPRD cloning plasmid |
|
CSB-CL019051HU-10ug |
Cusabio |
10ug |
EUR 1918 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 4521
- Sequence: ATGGTGCACGTAGCCAGGCTGCTGCTGCTGCTCCTCACTTTCTTCCTCCGCACGGATGCTGAGACACCTCCAAGGTTTACACGAACACCCGTTGATCAGACAGGGGTCTCTGGCGGAGTTGCCTCTTTCATCTGCCAAGCTACGGGAGACCCAAGACCTAAAATTGTCTGGAACA
- Show more
|
|
Description: A cloning plasmid for the PTPRD gene. |
 polyclonal antibody) Protein tyrosine phosphatase receptor type D (PTPRD) polyclonal antibody |
|
ABP-PAB-11040 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Phosphatases
- Brand:
|
 Mouse PTPRD shRNA Plasmid |
|
20-abx972302 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human PTPRD shRNA Plasmid |
|
20-abx953911 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human CellExp? PTPRD, Human Recombinant |
|
P1184-10 |
Biovision |
|
EUR 153 |
Human CellExp? PTPRD, Human Recombinant |
|
P1184-50 |
Biovision |
|
EUR 512 |
 (pORF)) PTPRD ORF Vector (Human) (pORF) |
|
ORF014206 |
ABM |
1.0 ug DNA |
EUR 354 |
 (pORF)) Ptprd ORF Vector (Mouse) (pORF) |
|
ORF055240 |
ABM |
1.0 ug DNA |
EUR 1572 |
Ptprd ORF Vector (Mouse) (pORF) |
|
ORF055241 |
ABM |
1.0 ug DNA |
EUR 506 |
 Antibody) Receptor-Type Tyrosine-Protein Phosphatase Delta (PTPRD) Antibody |
|
20-abx124253 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
) Ptprd sgRNA CRISPR Lentivector set (Mouse) |
|
K3953401 |
ABM |
3 x 1.0 ug |
EUR 339 |
) PTPRD sgRNA CRISPR Lentivector set (Human) |
|
K1757701 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) Ptprd sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3953402 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Ptprd sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3953403 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Ptprd sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3953404 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) PTPRD sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K1757702 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) PTPRD sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K1757703 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) PTPRD sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K1757704 |
ABM |
1.0 ug DNA |
EUR 154 |
 PTPRD 3'UTR Luciferase Stable Cell Line |
|
TU019222 |
ABM |
1.0 ml |
EUR 4617 |
 Ptprd 3'UTR Luciferase Stable Cell Line |
|
TU117289 |
ABM |
1.0 ml |
Ask for price |
 Ptprd 3'UTR GFP Stable Cell Line |
|
TU167289 |
ABM |
1.0 ml |
Ask for price |
Ptprd 3'UTR Luciferase Stable Cell Line |
|
TU217082 |
ABM |
1.0 ml |
Ask for price |
Ptprd 3'UTR GFP Stable Cell Line |
|
TU267082 |
ABM |
1.0 ml |
Ask for price |
 PTPRD 3'UTR GFP Stable Cell Line |
|
TU069222 |
ABM |
1.0 ml |
EUR 4617 |
 (pPB-C-His)) PTPRD Protein Vector (Human) (pPB-C-His) |
|
PV056821 |
ABM |
500 ng |
EUR 481 |
 (pPB-N-His)) PTPRD Protein Vector (Human) (pPB-N-His) |
|
PV056822 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-HA)) PTPRD Protein Vector (Human) (pPM-C-HA) |
|
PV056823 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-His)) PTPRD Protein Vector (Human) (pPM-C-His) |
|
PV056824 |
ABM |
500 ng |
EUR 481 |
 (pPB-C-His)) PTPRD Protein Vector (Mouse) (pPB-C-His) |
|
PV220958 |
ABM |
500 ng |
EUR 2550 |
 (pPB-N-His)) PTPRD Protein Vector (Mouse) (pPB-N-His) |
|
PV220959 |
ABM |
500 ng |
EUR 2550 |
 (pPM-C-HA)) PTPRD Protein Vector (Mouse) (pPM-C-HA) |
|
PV220960 |
ABM |
500 ng |
EUR 2550 |
 (pPM-C-His)) PTPRD Protein Vector (Mouse) (pPM-C-His) |
|
PV220961 |
ABM |
500 ng |
EUR 2550 |
PTPRD Protein Vector (Mouse) (pPB-C-His) |
|
PV220962 |
ABM |
500 ng |
EUR 1065 |
PTPRD Protein Vector (Mouse) (pPB-N-His) |
|
PV220963 |
ABM |
500 ng |
EUR 1065 |
PTPRD Protein Vector (Mouse) (pPM-C-HA) |
|
PV220964 |
ABM |
500 ng |
EUR 1065 |
PTPRD Protein Vector (Mouse) (pPM-C-His) |
|
PV220965 |
ABM |
500 ng |
EUR 1065 |
 GAPDH Rabbit Polyclonal Antibody |
|
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
|
37985-50ul |
SAB |
50ul |
EUR 187 |
 EFHD1 Rabbit Polyclonal Antibody |
|
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
|
38001-50ul |
SAB |
50ul |
EUR 187 |
 Alliinase Rabbit Polyclonal Antibody |
|
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
|
38042-50ul |
SAB |
50ul |
EUR 187 |
 ECFP Rabbit Polyclonal Antibody |
|
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
|
38077-50ul |
SAB |
50ul |
EUR 187 |
 EYFP Rabbit Polyclonal Antibody |
|
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
|
38078-50ul |
SAB |
50ul |
EUR 187 |
 mOrange Rabbit Polyclonal Antibody |
|
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
|
38079-50ul |
SAB |
50ul |
EUR 187 |
 mStrawberry Rabbit Polyclonal Antibody |
|
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
|
38083-50ul |
SAB |
50ul |
EUR 187 |
 AmCyan Rabbit Polyclonal Antibody |
|
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
|
38086-50ul |
SAB |
50ul |
EUR 187 |
 EBFP Rabbit Polyclonal Antibody |
|
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
|
38087-50ul |
SAB |
50ul |
EUR 187 |
 Vimentin Rabbit Polyclonal Antibody |
|
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
|
38104-50ul |
SAB |
50ul |
EUR 187 |
 LDHD Rabbit Polyclonal Antibody |
|
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
|
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
 Rabbit Hemoglobin Polyclonal Antibody |
|
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
PTPRD Rabbit Polyclonal Antibody
