October 17, 2021

PTPRD Rabbit Polyclonal Antibody

PTPRD Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

PTPRD Polyclonal Antibody

31600-100ul 100ul
EUR 252

PTPRD Polyclonal Antibody

31600-50ul 50ul
EUR 187

Polyclonal PTPRD Antibody

APR13026G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PTPRD . This antibody is tested and proven to work in the following applications:

PTPRD Polyclonal Antibody

ABP60036-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human PTPRD protein at amino acid sequence of 510-590
  • Applications tips:
Description: A polyclonal antibody for detection of PTPRD from Human, Mouse. This PTPRD antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTPRD protein at amino acid sequence of 510-590

PTPRD Polyclonal Antibody

ABP60036-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PTPRD protein at amino acid sequence of 510-590
  • Applications tips:
Description: A polyclonal antibody for detection of PTPRD from Human, Mouse. This PTPRD antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTPRD protein at amino acid sequence of 510-590

PTPRD Polyclonal Antibody

ABP60036-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PTPRD protein at amino acid sequence of 510-590
  • Applications tips:
Description: A polyclonal antibody for detection of PTPRD from Human, Mouse. This PTPRD antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTPRD protein at amino acid sequence of 510-590

PTPRD Polyclonal Antibody

ES10140-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PTPRD from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PTPRD Polyclonal Antibody

ES10140-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PTPRD from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PTPRD Rabbit pAb

A15713-100ul 100 ul
EUR 308

PTPRD Rabbit pAb

A15713-200ul 200 ul
EUR 459

PTPRD Rabbit pAb

A15713-20ul 20 ul
EUR 183

PTPRD Rabbit pAb

A15713-50ul 50 ul
EUR 223

PTPRD Rabbit pAb

A8559-100ul 100 ul
EUR 308

PTPRD Rabbit pAb

A8559-200ul 200 ul
EUR 459

PTPRD Rabbit pAb

A8559-20ul 20 ul
EUR 183

PTPRD Rabbit pAb

A8559-50ul 50 ul
EUR 223

PTPRD Rabbit pAb

A15089-100ul 100 ul
EUR 308

PTPRD Rabbit pAb

A15089-200ul 200 ul
EUR 459

PTPRD Rabbit pAb

A15089-20ul 20 ul
EUR 183

PTPRD Rabbit pAb

A15089-50ul 50 ul
EUR 223

PTPRD Polyclonal Conjugated Antibody

C31600 100ul
EUR 397

PTPRD Polyclonal Conjugated Antibody

C28823 100ul
EUR 397

PTPRD Polyclonal Conjugated Antibody

C29396 100ul
EUR 397

PTPRD Antibody

25495-100ul 100ul
EUR 390

Anti-PTPRD antibody

STJ111295 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular region, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region of this protein is composed of three Ig-like and eight fibronectin type III-like domains. Studies of the similar genes in chicken and fly suggest the role of this PTP is in promoting neurite growth, and regulating neurons axon guidance. Multiple alternatively spliced transcript variants of this gene have been reported. A related pseudogene has been identified on chromosome 5.

Anti-PTPRD antibody

STJ117283 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular region, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region of this protein is composed of three Ig-like and eight fibronectin type III-like domains. Studies of the similar genes in chicken and fly suggest the role of this PTP is in promoting neurite growth, and regulating neurons axon guidance. Multiple alternatively spliced transcript variants of this gene have been reported. A related pseudogene has been identified on chromosome 5.

Anti-PTPRD antibody

STJ118173 100 µl
EUR 277

Anti-PTPRD antibody

STJ191298 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PTPRD

PTPRD siRNA

20-abx930399
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PTPRD siRNA

20-abx930400
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PTPRD cloning plasmid

CSB-CL019051HU-10ug 10ug
EUR 1918
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 4521
  • Sequence: ATGGTGCACGTAGCCAGGCTGCTGCTGCTGCTCCTCACTTTCTTCCTCCGCACGGATGCTGAGACACCTCCAAGGTTTACACGAACACCCGTTGATCAGACAGGGGTCTCTGGCGGAGTTGCCTCTTTCATCTGCCAAGCTACGGGAGACCCAAGACCTAAAATTGTCTGGAACA
  • Show more
Description: A cloning plasmid for the PTPRD gene.

Protein tyrosine phosphatase receptor type D (PTPRD) polyclonal antibody

ABP-PAB-11040 100 ug Ask for price
    • Product line: Phosphatases
    • Brand:

Human PTPRD ELISA KIT

ELI-30528h 96 Tests
EUR 824

Mouse Ptprd ELISA KIT

ELI-43092m 96 Tests
EUR 865

Mouse PTPRD shRNA Plasmid

20-abx972302
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PTPRD shRNA Plasmid

20-abx953911
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CellExp? PTPRD, Human Recombinant

P1184-10
EUR 153

Human CellExp? PTPRD, Human Recombinant

P1184-50
EUR 512

PTPRD ORF Vector (Human) (pORF)

ORF014206 1.0 ug DNA
EUR 354

Ptprd ORF Vector (Mouse) (pORF)

ORF055240 1.0 ug DNA
EUR 1572

Ptprd ORF Vector (Mouse) (pORF)

ORF055241 1.0 ug DNA
EUR 506

Receptor-Type Tyrosine-Protein Phosphatase Delta (PTPRD) Antibody

20-abx124253
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ptprd sgRNA CRISPR Lentivector set (Mouse)

K3953401 3 x 1.0 ug
EUR 339

PTPRD sgRNA CRISPR Lentivector set (Human)

K1757701 3 x 1.0 ug
EUR 339

Ptprd sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3953402 1.0 ug DNA
EUR 154

Ptprd sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3953403 1.0 ug DNA
EUR 154

Ptprd sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3953404 1.0 ug DNA
EUR 154

PTPRD sgRNA CRISPR Lentivector (Human) (Target 1)

K1757702 1.0 ug DNA
EUR 154

PTPRD sgRNA CRISPR Lentivector (Human) (Target 2)

K1757703 1.0 ug DNA
EUR 154

PTPRD sgRNA CRISPR Lentivector (Human) (Target 3)

K1757704 1.0 ug DNA
EUR 154

PTPRD Protein Vector (Human) (pPB-C-His)

PV056821 500 ng
EUR 481

PTPRD Protein Vector (Human) (pPB-N-His)

PV056822 500 ng
EUR 481

PTPRD Protein Vector (Human) (pPM-C-HA)

PV056823 500 ng
EUR 481

PTPRD Protein Vector (Human) (pPM-C-His)

PV056824 500 ng
EUR 481

PTPRD Protein Vector (Mouse) (pPB-C-His)

PV220958 500 ng
EUR 2550

PTPRD Protein Vector (Mouse) (pPB-N-His)

PV220959 500 ng
EUR 2550

PTPRD Protein Vector (Mouse) (pPM-C-HA)

PV220960 500 ng
EUR 2550

PTPRD Protein Vector (Mouse) (pPM-C-His)

PV220961 500 ng
EUR 2550

PTPRD Protein Vector (Mouse) (pPB-C-His)

PV220962 500 ng
EUR 1065

PTPRD Protein Vector (Mouse) (pPB-N-His)

PV220963 500 ng
EUR 1065

PTPRD Protein Vector (Mouse) (pPM-C-HA)

PV220964 500 ng
EUR 1065

PTPRD Protein Vector (Mouse) (pPM-C-His)

PV220965 500 ng
EUR 1065

Ptprd 3'UTR Luciferase Stable Cell Line

TU117289 1.0 ml Ask for price

Ptprd 3'UTR GFP Stable Cell Line

TU167289 1.0 ml Ask for price

Ptprd 3'UTR Luciferase Stable Cell Line

TU217082 1.0 ml Ask for price

Ptprd 3'UTR GFP Stable Cell Line

TU267082 1.0 ml Ask for price

PTPRD 3'UTR GFP Stable Cell Line

TU069222 1.0 ml
EUR 4617

PTPRD 3'UTR Luciferase Stable Cell Line

TU019222 1.0 ml
EUR 4617

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

PTPRD Rabbit Polyclonal Antibody