January 18, 2022

SF3A3 Rabbit Polyclonal Antibody

SF3A3 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

SF3A3 Polyclonal Antibody

ES10306-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SF3A3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

SF3A3 Rabbit pAb

A4465-100ul 100 ul
EUR 308

SF3A3 Rabbit pAb

A4465-200ul 200 ul
EUR 459

SF3A3 Rabbit pAb

A4465-20ul 20 ul
EUR 183

SF3A3 Rabbit pAb

A4465-50ul 50 ul
EUR 223

SF3A3 antibody

70R-20194 50 ul
EUR 435
Description: Rabbit polyclonal SF3A3 antibody

SF3A3 Antibody

47199-100ul 100ul
EUR 252

SF3A3 Antibody

44691-100ul 100ul
EUR 252

SF3A3 Antibody

44691-50ul 50ul
EUR 187

SF3A3 Antibody

DF2246 200ul
EUR 304
Description: SF3A3 antibody detects endogenous levels of total SF3A3.

SF3A3 antibody

70R-4856 50 ug
EUR 467
Description: Rabbit polyclonal SF3A3 antibody raised against the middle region of SF3A3

SF3A3 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SF3A3. Recognizes SF3A3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

SF3A3 Antibody

ABD2246 100 ug
EUR 438

SF3A3 Conjugated Antibody

C44691 100ul
EUR 397

SF3A3 Conjugated Antibody

C47199 100ul
EUR 397

anti- SF3A3 antibody

FNab07776 100µg
EUR 548.75
  • Immunogen: splicing factor 3a, subunit 3, 60kDa
  • Uniprot ID: Q12874
  • Gene ID: 10946
  • Research Area: Neuroscience, Metabolism, Epigenetics
Description: Antibody raised against SF3A3

Anti-SF3A3 antibody

PAab07776 100 ug
EUR 386

Anti-SF3A3 antibody

STJ25497 100 µl
EUR 277
Description: This gene encodes subunit 3 of the splicing factor 3a protein complex. The splicing factor 3a heterotrimer includes subunits 1, 2 and 3 and is necessary for the in vitro conversion of 15S U2 snRNP into an active 17S particle that performs pre-mRNA splicing. Subunit 3 interacts with subunit 1 through its amino-terminus while the zinc finger domain of subunit 3 plays a role in its binding to the 15S U2 snRNP. This gene has a pseudogene on chromosome 20. Alternative splicing results in multiple transcript variants.

Anti-SF3A3 antibody

STJ191464 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SF3A3


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


PVT18376 2 ug
EUR 231

SF3A3 Blocking Peptide

33R-9103 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SF3A3 antibody, catalog no. 70R-4856

SF3A3 Blocking Peptide

DF2246-BP 1mg
EUR 195

SF3A3 cloning plasmid

CSB-CL619637HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1506
  • Sequence: atggagacaatactggagcagcagcggcgctatcatgaggagaaggaacggctcatggacgtcatggctaaagagatgctcaccaagaagtccacgctccgggaccagatcaattctgatcaccgcactcgggccatgcaagataggtatatggaggtcagtgggaacctgaggg
  • Show more
Description: A cloning plasmid for the SF3A3 gene.

SF3A3 cloning plasmid

CSB-CL619637HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1506
  • Sequence: atggagacaatactggagcagcagcggcgctatcatgaggagaaggaacggctcatggacgtcatggctaaagagatgctcaccaagaagtccacgctccgggaccagatcaattctgatcaccgcactcgggccatgcaagataggtatatggaggtcagtgggaacctgaggg
  • Show more
Description: A cloning plasmid for the SF3A3 gene.


PVT13084 2 ug
EUR 391


EF002852 96 Tests
EUR 689

Mouse SF3A3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SF3A3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SF3A3 Recombinant Protein (Human)

RP028273 100 ug Ask for price

SF3A3 Recombinant Protein (Human)

RP028276 100 ug Ask for price

SF3A3 Recombinant Protein (Rat)

RP228353 100 ug Ask for price

SF3A3 Recombinant Protein (Mouse)

RP171320 100 ug Ask for price

Anti-SF3A3 (2E9-2B7)

YF-MA17536 200 ul
EUR 363
Description: Mouse monoclonal to SF3A3

Splicing Factor 3A Subunit 3 (SF3A3) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Splicing Factor 3A Subunit 3 (SF3A3) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Splicing Factor 3A Subunit 3 (SF3A3) Antibody

abx237776-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Sf3a3 ORF Vector (Rat) (pORF)

ORF076119 1.0 ug DNA
EUR 506

SF3A3 ORF Vector (Human) (pORF)

ORF009425 1.0 ug DNA
EUR 95

SF3A3 ORF Vector (Human) (pORF)

ORF009426 1.0 ug DNA
EUR 95

Sf3a3 ORF Vector (Mouse) (pORF)

ORF057108 1.0 ug DNA
EUR 506

Sf3a3 sgRNA CRISPR Lentivector set (Rat)

K7259001 3 x 1.0 ug
EUR 339

Sf3a3 sgRNA CRISPR Lentivector set (Mouse)

K4123801 3 x 1.0 ug
EUR 339

SF3A3 sgRNA CRISPR Lentivector set (Human)

K2130101 3 x 1.0 ug
EUR 339

Splicing Factor 3A, Subunit 3, 60 kDa (SF3A3) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sf3a3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7259002 1.0 ug DNA
EUR 154

Sf3a3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7259003 1.0 ug DNA
EUR 154

Sf3a3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7259004 1.0 ug DNA
EUR 154

Sf3a3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4123802 1.0 ug DNA
EUR 154

Sf3a3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4123803 1.0 ug DNA
EUR 154

Sf3a3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4123804 1.0 ug DNA
EUR 154

SF3A3 sgRNA CRISPR Lentivector (Human) (Target 1)

K2130102 1.0 ug DNA
EUR 154

SF3A3 sgRNA CRISPR Lentivector (Human) (Target 2)

K2130103 1.0 ug DNA
EUR 154

SF3A3 sgRNA CRISPR Lentivector (Human) (Target 3)

K2130104 1.0 ug DNA
EUR 154

SF3A3 Protein Vector (Rat) (pPB-C-His)

PV304474 500 ng
EUR 603

SF3A3 Protein Vector (Rat) (pPB-N-His)

PV304475 500 ng
EUR 603

SF3A3 Protein Vector (Rat) (pPM-C-HA)

PV304476 500 ng
EUR 603

SF3A3 Protein Vector (Rat) (pPM-C-His)

PV304477 500 ng
EUR 603

SF3A3 Protein Vector (Human) (pPB-C-His)

PV037697 500 ng
EUR 329

SF3A3 Protein Vector (Human) (pPB-N-His)

PV037698 500 ng
EUR 329

SF3A3 Protein Vector (Human) (pPM-C-HA)

PV037699 500 ng
EUR 329

SF3A3 Protein Vector (Human) (pPM-C-His)

PV037700 500 ng
EUR 329

SF3A3 Protein Vector (Human) (pPB-C-His)

PV037701 500 ng
EUR 329

SF3A3 Protein Vector (Human) (pPB-N-His)

PV037702 500 ng
EUR 329

SF3A3 Protein Vector (Human) (pPM-C-HA)

PV037703 500 ng
EUR 329

SF3A3 Protein Vector (Human) (pPM-C-His)

PV037704 500 ng
EUR 329

SF3A3 Protein Vector (Mouse) (pPB-C-His)

PV228430 500 ng
EUR 603

SF3A3 Protein Vector (Mouse) (pPB-N-His)

PV228431 500 ng
EUR 603

SF3A3 Protein Vector (Mouse) (pPM-C-HA)

PV228432 500 ng
EUR 603

SF3A3 Protein Vector (Mouse) (pPM-C-His)

PV228433 500 ng
EUR 603

Sf3a3 3'UTR Luciferase Stable Cell Line

TU118679 1.0 ml Ask for price

Sf3a3 3'UTR GFP Stable Cell Line

TU168679 1.0 ml Ask for price

Sf3a3 3'UTR Luciferase Stable Cell Line

TU220223 1.0 ml Ask for price

Sf3a3 3'UTR GFP Stable Cell Line

TU270223 1.0 ml Ask for price

SF3A3 3'UTR GFP Stable Cell Line

TU073014 1.0 ml
EUR 1394

SF3A3 3'UTR Luciferase Stable Cell Line

TU023014 1.0 ml
EUR 1394

SF3A3 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV714963 1.0 ug DNA
EUR 316

SF3A3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV714967 1.0 ug DNA
EUR 316

SF3A3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV714968 1.0 ug DNA
EUR 316

SF3A3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV630889 1.0 ug DNA
EUR 682

SF3A3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV630893 1.0 ug DNA
EUR 682

SF3A3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV630894 1.0 ug DNA
EUR 682

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

SF3A3 Rabbit Polyclonal Antibody