TAF7 Rabbit Polyclonal Antibody

TAF7 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

TAF7 Polyclonal Antibody
ABP60612-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human TAF7 protein Applications tips:
Description: A polyclonal antibody for detection of TAF7 from Human, Mouse. This TAF7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TAF7 protein

TAF7 Polyclonal Antibody
ES10382-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against TAF7 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

TAF7 Polyclonal Antibody
ES10382-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against TAF7 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

TAF7 Rabbit pAb
A8906-100ul	Abclonal	100 ul	EUR 308

TAF7 Rabbit pAb
A8906-200ul	Abclonal	200 ul	EUR 459

TAF7 Rabbit pAb
A8906-20ul	Abclonal	20 ul	Ask for price

TAF7 Rabbit pAb
A8906-50ul	Abclonal	50 ul	Ask for price

TAF7 antibody
70R-20695	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal TAF7 antibody

TAF7 Antibody
44694-100ul	SAB	100ul	EUR 252

TAF7 Antibody
44694-50ul	SAB	50ul	EUR 187

TAF7 Antibody
DF2253	Affbiotech	200ul	EUR 304
Description: TAF7 antibody detects endogenous levels of total TAF7.

TAF7 Antibody
1-CSB-PA023097GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TAF7. Recognizes TAF7 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

TAF7 Antibody
ABD2253	Lifescience Market	100 ug	EUR 438

TAF7 Conjugated Antibody
C44694	SAB	100ul	EUR 397

anti- TAF7 antibody
FNab08488	FN Test	100µg	EUR 548.75
Immunogen: TAF7 RNA polymerase II, TATA box binding protein(TBP)-associated factor, 55kDa Uniprot ID: Q15545 Gene ID: 6879 Research Area: Metabolism
Description: Antibody raised against TAF7

Anti-TAF7 antibody
PAab08488	Lifescience Market	100 ug	EUR 386

Anti-TAF7 antibody
STJ111471	St John's Laboratory	100 µl	EUR 277
Description: The intronless gene for this transcription coactivator is located between the protocadherin beta and gamma gene clusters on chromosome 5. The protein encoded by this gene is a component of the TFIID protein complex, a complex which binds to the TATA box in class II promoters and recruits RNA polymerase II and other factors. This particular subunit interacts with the largest TFIID subunit, as well as multiple transcription activators. The protein is required for transcription by promoters targeted by RNA polymerase II.

Anti-TAF7 antibody
STJ191540	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to TAF7

TAF7 siRNA
20-abx935987	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TAF7 siRNA
20-abx935988	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-TAF7
YF-PA14896	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to TAF7

anti-TAF7
YF-PA14897	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to TAF7

TAF7 Blocking Peptide
DF2253-BP	Affbiotech	1mg	EUR 195

TAF7 cloning plasmid
CSB-CL623003HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1050 Sequence: atgagtaaaagcaaagatgatgctcctcacgaactggagagccagtttatcttacgtctgcctccagaatatgcctctactgtgagaagggcagtacagtctggtcatgtcaacctcaaggacagactgacaattgagttacatcctgatgggcgtcatggaatcgtcagagtgg Show more
Description: A cloning plasmid for the TAF7 gene.

Anti-TAF7 (2C5)
YF-MA10904	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to TAF7

Anti-TAF7 (3G6)
YF-MA15712	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to TAF7

Bovine TAF7 ELISA KIT
ELI-13729b	Lifescience Market	96 Tests	EUR 928

Human TAF7 ELISA KIT
ELI-17300h	Lifescience Market	96 Tests	EUR 824

TAF7 ELISA KIT|Human
EF003442	Lifescience Market	96 Tests	EUR 689

Mouse TAF7 shRNA Plasmid
20-abx973631	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human TAF7 shRNA Plasmid
20-abx954708	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse Taf7 ELISA KIT
ELI-41689m	Lifescience Market	96 Tests	EUR 865

TAF7 Recombinant Protein (Rat)
RP232184	ABM	100 ug	Ask for price

TAF7 Recombinant Protein (Human)
RP030865	ABM	100 ug	Ask for price

TAF7 Recombinant Protein (Mouse)
RP177131	ABM	100 ug	Ask for price

Taf7 ORF Vector (Rat) (pORF)
ORF077396	ABM	1.0 ug DNA	EUR 506

TAF7 ORF Vector (Human) (pORF)
ORF010289	ABM	1.0 ug DNA	EUR 95

Taf7 ORF Vector (Mouse) (pORF)
ORF059045	ABM	1.0 ug DNA	EUR 506

Taf7 sgRNA CRISPR Lentivector set (Mouse)
K4900401	ABM	3 x 1.0 ug	EUR 339

Taf7 sgRNA CRISPR Lentivector set (Rat)
K6677801	ABM	3 x 1.0 ug	EUR 339

TAF7 sgRNA CRISPR Lentivector set (Human)
K2328701	ABM	3 x 1.0 ug	EUR 339

TATA-Box Binding Protein Associated Factor 7 (TAF7) Antibody
abx028227-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

TATA-Box Binding Protein Associated Factor 7 (TAF7) Antibody
abx028227-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

TATA-Box Binding Protein Associated Factor 7 (TAF7) Antibody
20-abx218315	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

TATA-Box Binding Protein Associated Factor 7 (TAF7) Antibody
20-abx115981	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

TATA-Box Binding Protein Associated Factor 7 (TAF7) Antibody
20-abx123701	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

TATA-Box Binding Protein Associated Factor 7 (TAF7) Antibody
abx238488-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Taf7 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4900402	ABM	1.0 ug DNA	EUR 154

Taf7 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4900403	ABM	1.0 ug DNA	EUR 154

Taf7 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4900404	ABM	1.0 ug DNA	EUR 154

Taf7 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6677802	ABM	1.0 ug DNA	EUR 154

Taf7 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6677803	ABM	1.0 ug DNA	EUR 154

Taf7 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6677804	ABM	1.0 ug DNA	EUR 154

TAF7 sgRNA CRISPR Lentivector (Human) (Target 1)
K2328702	ABM	1.0 ug DNA	EUR 154

TAF7 sgRNA CRISPR Lentivector (Human) (Target 2)
K2328703	ABM	1.0 ug DNA	EUR 154

TAF7 sgRNA CRISPR Lentivector (Human) (Target 3)
K2328704	ABM	1.0 ug DNA	EUR 154

TAF7 Protein Vector (Rat) (pPB-C-His)
PV309582	ABM	500 ng	EUR 603

TAF7 Protein Vector (Rat) (pPB-N-His)
PV309583	ABM	500 ng	EUR 603

TAF7 Protein Vector (Rat) (pPM-C-HA)
PV309584	ABM	500 ng	EUR 603

TAF7 Protein Vector (Rat) (pPM-C-His)
PV309585	ABM	500 ng	EUR 603

TAF7 Protein Vector (Human) (pPB-C-His)
PV041153	ABM	500 ng	EUR 329

TAF7 Protein Vector (Human) (pPB-N-His)
PV041154	ABM	500 ng	EUR 329

TAF7 Protein Vector (Human) (pPM-C-HA)
PV041155	ABM	500 ng	EUR 329

TAF7 Protein Vector (Human) (pPM-C-His)
PV041156	ABM	500 ng	EUR 329

TAF7 Protein Vector (Mouse) (pPB-C-His)
PV236178	ABM	500 ng	EUR 603

TAF7 Protein Vector (Mouse) (pPB-N-His)
PV236179	ABM	500 ng	EUR 603

TAF7 Protein Vector (Mouse) (pPM-C-HA)
PV236180	ABM	500 ng	EUR 603

TAF7 Protein Vector (Mouse) (pPM-C-His)
PV236181	ABM	500 ng	EUR 603

Taf7 3'UTR Luciferase Stable Cell Line
TU120111	ABM	1.0 ml	Ask for price

Taf7 3'UTR GFP Stable Cell Line
TU170111	ABM	1.0 ml	Ask for price

Taf7 3'UTR Luciferase Stable Cell Line
TU221553	ABM	1.0 ml	Ask for price

TAF7 3'UTR GFP Stable Cell Line
TU075089	ABM	1.0 ml	EUR 1394

Taf7 3'UTR GFP Stable Cell Line
TU271553	ABM	1.0 ml	Ask for price

TAF7 3'UTR Luciferase Stable Cell Line
TU025089	ABM	1.0 ml	EUR 1394

TAF7 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV622627	ABM	1.0 ug DNA	EUR 682

TAF7 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV622631	ABM	1.0 ug DNA	EUR 682

TAF7 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV622632	ABM	1.0 ug DNA	EUR 682

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul	SAB	100ul	EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul	SAB	50ul	EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul	SAB	100ul	EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul	SAB	50ul	EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul	SAB	100ul	EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul	SAB	50ul	EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul	SAB	100ul	EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul	SAB	50ul	EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul	SAB	100ul	EUR 252

TAF7 Rabbit Polyclonal Antibody