January 17, 2022

TAF7 Rabbit Polyclonal Antibody

TAF7 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

TAF7 Polyclonal Antibody

ABP60612-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human TAF7 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TAF7 from Human, Mouse. This TAF7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TAF7 protein

TAF7 Polyclonal Antibody

ES10382-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TAF7 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

TAF7 Polyclonal Antibody

ES10382-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TAF7 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

TAF7 Rabbit pAb

A8906-100ul 100 ul
EUR 308

TAF7 Rabbit pAb

A8906-200ul 200 ul
EUR 459

TAF7 Rabbit pAb

A8906-20ul 20 ul Ask for price

TAF7 Rabbit pAb

A8906-50ul 50 ul Ask for price

TAF7 antibody

70R-20695 50 ul
EUR 435
Description: Rabbit polyclonal TAF7 antibody

TAF7 Antibody

44694-100ul 100ul
EUR 252

TAF7 Antibody

44694-50ul 50ul
EUR 187

TAF7 Antibody

DF2253 200ul
EUR 304
Description: TAF7 antibody detects endogenous levels of total TAF7.

TAF7 Antibody

1-CSB-PA023097GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TAF7. Recognizes TAF7 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

TAF7 Antibody

ABD2253 100 ug
EUR 438

TAF7 Conjugated Antibody

C44694 100ul
EUR 397

anti- TAF7 antibody

FNab08488 100µg
EUR 548.75
  • Immunogen: TAF7 RNA polymerase II, TATA box binding protein(TBP)-associated factor, 55kDa
  • Uniprot ID: Q15545
  • Gene ID: 6879
  • Research Area: Metabolism
Description: Antibody raised against TAF7

Anti-TAF7 antibody

PAab08488 100 ug
EUR 386

Anti-TAF7 antibody

STJ111471 100 µl
EUR 277
Description: The intronless gene for this transcription coactivator is located between the protocadherin beta and gamma gene clusters on chromosome 5. The protein encoded by this gene is a component of the TFIID protein complex, a complex which binds to the TATA box in class II promoters and recruits RNA polymerase II and other factors. This particular subunit interacts with the largest TFIID subunit, as well as multiple transcription activators. The protein is required for transcription by promoters targeted by RNA polymerase II.

Anti-TAF7 antibody

STJ191540 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TAF7

TAF7 siRNA

20-abx935987
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TAF7 siRNA

20-abx935988
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-TAF7

YF-PA14896 50 ul
EUR 363
Description: Mouse polyclonal to TAF7

anti-TAF7

YF-PA14897 100 ug
EUR 403
Description: Rabbit polyclonal to TAF7

TAF7 Blocking Peptide

DF2253-BP 1mg
EUR 195

TAF7 cloning plasmid

CSB-CL623003HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1050
  • Sequence: atgagtaaaagcaaagatgatgctcctcacgaactggagagccagtttatcttacgtctgcctccagaatatgcctctactgtgagaagggcagtacagtctggtcatgtcaacctcaaggacagactgacaattgagttacatcctgatgggcgtcatggaatcgtcagagtgg
  • Show more
Description: A cloning plasmid for the TAF7 gene.

Anti-TAF7 (2C5)

YF-MA10904 100 ug
EUR 363
Description: Mouse monoclonal to TAF7

Anti-TAF7 (3G6)

YF-MA15712 100 ug
EUR 363
Description: Mouse monoclonal to TAF7

Bovine TAF7 ELISA KIT

ELI-13729b 96 Tests
EUR 928

Human TAF7 ELISA KIT

ELI-17300h 96 Tests
EUR 824

TAF7 ELISA KIT|Human

EF003442 96 Tests
EUR 689

Mouse TAF7 shRNA Plasmid

20-abx973631
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human TAF7 shRNA Plasmid

20-abx954708
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Taf7 ELISA KIT

ELI-41689m 96 Tests
EUR 865

TAF7 Recombinant Protein (Rat)

RP232184 100 ug Ask for price

TAF7 Recombinant Protein (Human)

RP030865 100 ug Ask for price

TAF7 Recombinant Protein (Mouse)

RP177131 100 ug Ask for price

Taf7 ORF Vector (Rat) (pORF)

ORF077396 1.0 ug DNA
EUR 506

TAF7 ORF Vector (Human) (pORF)

ORF010289 1.0 ug DNA
EUR 95

Taf7 ORF Vector (Mouse) (pORF)

ORF059045 1.0 ug DNA
EUR 506

Taf7 sgRNA CRISPR Lentivector set (Mouse)

K4900401 3 x 1.0 ug
EUR 339

Taf7 sgRNA CRISPR Lentivector set (Rat)

K6677801 3 x 1.0 ug
EUR 339

TAF7 sgRNA CRISPR Lentivector set (Human)

K2328701 3 x 1.0 ug
EUR 339

TATA-Box Binding Protein Associated Factor 7 (TAF7) Antibody

abx028227-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

TATA-Box Binding Protein Associated Factor 7 (TAF7) Antibody

abx028227-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

TATA-Box Binding Protein Associated Factor 7 (TAF7) Antibody

20-abx218315
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

TATA-Box Binding Protein Associated Factor 7 (TAF7) Antibody

20-abx115981
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

TATA-Box Binding Protein Associated Factor 7 (TAF7) Antibody

20-abx123701
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

TATA-Box Binding Protein Associated Factor 7 (TAF7) Antibody

abx238488-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Taf7 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4900402 1.0 ug DNA
EUR 154

Taf7 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4900403 1.0 ug DNA
EUR 154

Taf7 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4900404 1.0 ug DNA
EUR 154

Taf7 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6677802 1.0 ug DNA
EUR 154

Taf7 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6677803 1.0 ug DNA
EUR 154

Taf7 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6677804 1.0 ug DNA
EUR 154

TAF7 sgRNA CRISPR Lentivector (Human) (Target 1)

K2328702 1.0 ug DNA
EUR 154

TAF7 sgRNA CRISPR Lentivector (Human) (Target 2)

K2328703 1.0 ug DNA
EUR 154

TAF7 sgRNA CRISPR Lentivector (Human) (Target 3)

K2328704 1.0 ug DNA
EUR 154

TAF7 Protein Vector (Rat) (pPB-C-His)

PV309582 500 ng
EUR 603

TAF7 Protein Vector (Rat) (pPB-N-His)

PV309583 500 ng
EUR 603

TAF7 Protein Vector (Rat) (pPM-C-HA)

PV309584 500 ng
EUR 603

TAF7 Protein Vector (Rat) (pPM-C-His)

PV309585 500 ng
EUR 603

TAF7 Protein Vector (Human) (pPB-C-His)

PV041153 500 ng
EUR 329

TAF7 Protein Vector (Human) (pPB-N-His)

PV041154 500 ng
EUR 329

TAF7 Protein Vector (Human) (pPM-C-HA)

PV041155 500 ng
EUR 329

TAF7 Protein Vector (Human) (pPM-C-His)

PV041156 500 ng
EUR 329

TAF7 Protein Vector (Mouse) (pPB-C-His)

PV236178 500 ng
EUR 603

TAF7 Protein Vector (Mouse) (pPB-N-His)

PV236179 500 ng
EUR 603

TAF7 Protein Vector (Mouse) (pPM-C-HA)

PV236180 500 ng
EUR 603

TAF7 Protein Vector (Mouse) (pPM-C-His)

PV236181 500 ng
EUR 603

Taf7 3'UTR Luciferase Stable Cell Line

TU120111 1.0 ml Ask for price

Taf7 3'UTR GFP Stable Cell Line

TU170111 1.0 ml Ask for price

Taf7 3'UTR Luciferase Stable Cell Line

TU221553 1.0 ml Ask for price

TAF7 3'UTR GFP Stable Cell Line

TU075089 1.0 ml
EUR 1394

Taf7 3'UTR GFP Stable Cell Line

TU271553 1.0 ml Ask for price

TAF7 3'UTR Luciferase Stable Cell Line

TU025089 1.0 ml
EUR 1394

TAF7 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV622627 1.0 ug DNA
EUR 682

TAF7 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV622631 1.0 ug DNA
EUR 682

TAF7 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV622632 1.0 ug DNA
EUR 682

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

TAF7 Rabbit Polyclonal Antibody