October 26, 2021

GPM6B Rabbit Polyclonal Antibody

GPM6B Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

GPM6B Polyclonal Antibody
ABP58684-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human GPM6B protein at amino acid sequence of 450-530
  • Applications tips:
Description: A polyclonal antibody for detection of GPM6B from Human, Mouse, Rat. This GPM6B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GPM6B protein at amino acid sequence of 450-530
GPM6B Polyclonal Antibody
ABP58684-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human GPM6B protein at amino acid sequence of 450-530
  • Applications tips:
Description: A polyclonal antibody for detection of GPM6B from Human, Mouse, Rat. This GPM6B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GPM6B protein at amino acid sequence of 450-530
GPM6B Polyclonal Antibody
ABP58684-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human GPM6B protein at amino acid sequence of 450-530
  • Applications tips:
Description: A polyclonal antibody for detection of GPM6B from Human, Mouse, Rat. This GPM6B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GPM6B protein at amino acid sequence of 450-530
GPM6B Polyclonal Antibody
ES9920-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GPM6B from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
GPM6B Polyclonal Antibody
ES9920-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GPM6B from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
GPM6B Antibody
46094-100ul 100ul
EUR 252
GPM6B Antibody
46094-50ul 50ul
EUR 187
GPM6B Antibody
1-CSB-PA614417LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPM6B. Recognizes GPM6B from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200
GPM6B Antibody
DF9700 200ul
EUR 304
Description: GPM6B Antibody detects endogenous levels of total GPM6B.
GPM6B Antibody
ABD9700 100 ug
EUR 438
Polyclonal GPM6B Antibody (N-term)
APR12203G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPM6B (N-term). This antibody is tested and proven to work in the following applications:
GPM6B Polyclonal Antibody, HRP Conjugated
A64671 100 µg
EUR 570.55
Description: The best epigenetics products
GPM6B Polyclonal Antibody, FITC Conjugated
A64672 100 µg
EUR 570.55
Description: kits suitable for this type of research
GPM6B Polyclonal Antibody, Biotin Conjugated
A64673 100 µg
EUR 570.55
Description: fast delivery possible
GPM6B Conjugated Antibody
C46094 100ul
EUR 397
Anti-GPM6B antibody
STJ191078 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to GPM6B
GPM6B siRNA
20-abx902263
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
GPM6B siRNA
20-abx918388
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
GPM6B siRNA
20-abx918389
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
GPM6B Antibody, HRP conjugated
1-CSB-PA614417LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPM6B. Recognizes GPM6B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
GPM6B Antibody, FITC conjugated
1-CSB-PA614417LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPM6B. Recognizes GPM6B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
GPM6B Antibody, Biotin conjugated
1-CSB-PA614417LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPM6B. Recognizes GPM6B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
GPM6B Blocking Peptide
DF9700-BP 1mg
EUR 195
GPM6B cloning plasmid
CSB-CL614417HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 918
  • Sequence: atgaagccagccatggaaactgcagccgaggaaaatactgaacaaagccaagagagaaaagtgaacagcagagctgaaatggaaattggcaggtaccactggatgtacccaggctcaaagaaccaccagtaccatcccgtgccaaccctgggggacagggctagccccttgagcag
  • Show more
Description: A cloning plasmid for the GPM6B gene.
pCMV-SPORT6-GPM6B
PVT12814 2 ug
EUR 391
GPM6B ELISA KIT|Human
EF005057 96 Tests
EUR 689
Rat GPM6B shRNA Plasmid
20-abx987832
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human GPM6B shRNA Plasmid
20-abx951889
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse GPM6B shRNA Plasmid
20-abx970629
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
GPM6B Recombinant Protein (Human)
RP013756 100 ug Ask for price
GPM6B Recombinant Protein (Rat)
RP203252 100 ug Ask for price
GPM6B Recombinant Protein (Mouse)
RP139346 100 ug Ask for price
GPM6B Recombinant Protein (Mouse)
RP139349 100 ug Ask for price
GPM6B Recombinant Protein (Mouse)
RP139352 100 ug Ask for price
GPM6B Recombinant Protein (Mouse)
RP139355 100 ug Ask for price
GPM6B Recombinant Protein (Mouse)
RP139358 100 ug Ask for price
GPM6B Recombinant Protein (Mouse)
RP139361 100 ug Ask for price
GPM6B Recombinant Protein (Mouse)
RP139364 100 ug Ask for price
GPM6B Recombinant Protein (Mouse)
RP139367 100 ug Ask for price
GPM6B Recombinant Protein (Mouse)
RP139370 100 ug Ask for price
Neuronal Membrane Glycoprotein M6-B (GPM6B) Antibody
abx026488-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Neuronal Membrane Glycoprotein M6-B (GPM6B) Antibody
abx026488-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Neuronal Membrane Glycoprotein M6-B (GPM6B) Antibody
20-abx216639
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Neuronal Membrane Glycoprotein M6-B (GPM6B) Antibody
20-abx318463
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Gpm6b ORF Vector (Rat) (pORF)
ORF067752 1.0 ug DNA
EUR 506
GPM6B ORF Vector (Human) (pORF)
ORF004586 1.0 ug DNA
EUR 95
Gpm6b ORF Vector (Mouse) (pORF)
ORF046450 1.0 ug DNA
EUR 506
Gpm6b ORF Vector (Mouse) (pORF)
ORF046451 1.0 ug DNA
EUR 506
Gpm6b ORF Vector (Mouse) (pORF)
ORF046452 1.0 ug DNA
EUR 506
Gpm6b ORF Vector (Mouse) (pORF)
ORF046453 1.0 ug DNA
EUR 506

GPM6B Rabbit Polyclonal Antibody