October 23, 2021

RAB5B Rabbit Polyclonal Antibody

RAB5B Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

RAB5B Polyclonal Antibody
ABP60069-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RAB5B protein at amino acid sequence of 90-170
  • Applications tips:
Description: A polyclonal antibody for detection of RAB5B from Human, Mouse. This RAB5B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB5B protein at amino acid sequence of 90-170
RAB5B Polyclonal Antibody
ABP60069-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RAB5B protein at amino acid sequence of 90-170
  • Applications tips:
Description: A polyclonal antibody for detection of RAB5B from Human, Mouse. This RAB5B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB5B protein at amino acid sequence of 90-170
RAB5B Polyclonal Antibody
ES10131-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RAB5B from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
RAB5B Polyclonal Antibody
ES10131-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RAB5B from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
RAB5B Rabbit pAb
A7447-100ul 100 ul
EUR 308
RAB5B Rabbit pAb
A7447-200ul 200 ul
EUR 459
RAB5B Rabbit pAb
A7447-20ul 20 ul
EUR 183
RAB5B Rabbit pAb
A7447-50ul 50 ul
EUR 223
Polyclonal RAB5B Antibody (Center)
APR13055G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAB5B (Center). This antibody is tested and proven to work in the following applications:
RAB5B antibody
70R-19720 50 ul
EUR 435
Description: Rabbit polyclonal RAB5B antibody
RAB5B Antibody
46191-100ul 100ul
EUR 252
RAB5B Antibody
46191-50ul 50ul
EUR 187
RAB5B Antibody
DF9834 200ul
EUR 304
Description: RAB5B Antibody detects endogenous levels of total RAB5B.
RAB5B antibody
70R-5873 50 ug
EUR 467
Description: Rabbit polyclonal RAB5B antibody raised against the N terminal of RAB5B
RAB5B Antibody
1-CSB-PA019214ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RAB5B. Recognizes RAB5B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200
RAB5B Antibody
1-CSB-PA019214ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RAB5B. Recognizes RAB5B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200
RAB5B Antibody
1-CSB-PA019214GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RAB5B. Recognizes RAB5B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
RAB5B Antibody
ABD13226 100 ug
EUR 438
RAB5B Antibody
ABD9834 100 ug
EUR 438
RAB5B, Member RAS Oncogene Family (RAB5B) Antibody
20-abx006959
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
RAB5B, Member RAS Oncogene Family (RAB5B) Antibody
20-abx218131
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
RAB5B, Member RAS Oncogene Family (RAB5B) Antibody
abx145141-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
RAB5B, Member RAS Oncogene Family (RAB5B) Antibody
abx030408-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
RAB5B, Member RAS Oncogene Family (RAB5B) Antibody
abx030408-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
RAB5B, Member RAS Oncogene Family (RAB5B) Antibody
abx237040-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
RAB5B, Member RAS Oncogene Family (RAB5B) Antibody
20-abx321877
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
RAB5B, Member RAS Oncogene Family (RAB5B) Antibody
20-abx321878
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
RAB5B Conjugated Antibody
C46191 100ul
EUR 397
anti- RAB5B antibody
FNab07040 100µg
EUR 505.25
  • Immunogen: RAB5B, member RAS oncogene family
  • Uniprot ID: P61020
  • Gene ID: 5869
  • Research Area: Cardiovascular, Signal Transduction
Description: Antibody raised against RAB5B
Anti-RAB5B antibody
PAab07040 100 ug
EUR 355
Anti-Rab5b antibody
STJ140061 200 µg
EUR 231
Description: Goat polyclonal antibody to mouse Rab5b. Rab5b belongs to the small GTPase superfamily, Rab family. Rab5b is an Early Endosome Marker and functions as a key regulator of vesicular trafficking during early endocytosis.
Anti-RAB5B antibody
STJ29583 100 µl
EUR 277
Anti-RAB5B antibody
STJ191289 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RAB5B
RAB5B siRNA
20-abx930695
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RAB5B siRNA
20-abx930696
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RAB5B Blocking Peptide
33R-6565 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAB5B antibody, catalog no. 70R-5873
RAB5B Blocking Peptide
DF9834-BP 1mg
EUR 195
RAB5B cloning plasmid
CSB-CL019214HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 648
  • Sequence: ATGACTAGCAGAAGCACAGCTAGGCCCAATGGGCAACCCCAGGCCAGCAAAATTTGCCAGTTCAAATTGGTCCTGCTGGGAGAATCTGCAGTGGGAAAGTCAAGCCTGGTATTACGTTTTGTCAAAGGGCAGTTCCATGAGTACCAGGAGAGCACCATTGGAGCGGCCTTCCTCAC
  • Show more
Description: A cloning plasmid for the RAB5B gene.
pCMV-SPORT6-RAB5B
PVT14173 2 ug
EUR 495
Monoclonal RAB5B Antibody, Clone: 1615CT668.28.45
APR13054G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human RAB5B. The antibodies are raised in Mouse and are from clone 1615CT668.28.45. This antibody is applicable in WB, E
Rab5B, Member Ras Oncogene Family Antibody
20-abx114998
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
RAB5B protein (His tag)
80R-1605 100 ug
EUR 305
Description: Purified recombinant Human RAB5B protein
RAB5B ELISA KIT|Human
EF002255 96 Tests
EUR 689
Mouse RAB5B shRNA Plasmid
20-abx972349
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human RAB5B shRNA Plasmid
20-abx953959
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
RAB5B Recombinant Protein (Human)
RP042685 100 ug Ask for price
RAB5B Recombinant Protein (Mouse)
RP166355 100 ug Ask for price
RAB5B Recombinant Protein (Rat)
RP223373 100 ug Ask for price
Rabbit Ras related protein Rab 5B(RAB5B) ELISA kit
E04R0383-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Ras related protein Rab 5B(RAB5B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Ras related protein Rab 5B(RAB5B) ELISA kit
E04R0383-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Ras related protein Rab 5B(RAB5B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Ras related protein Rab 5B(RAB5B) ELISA kit
E04R0383-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Ras related protein Rab 5B(RAB5B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rab5b ORF Vector (Rat) (pORF)
ORF074459 1.0 ug DNA
EUR 506
RAB5B ORF Vector (Human) (pORF)
ORF014229 1.0 ug DNA
EUR 354
Rab5b ORF Vector (Mouse) (pORF)
ORF055453 1.0 ug DNA
EUR 506
RAB5B ELISA Kit (Human) (OKCA00796)
OKCA00796 96 Wells
EUR 833
Description: Description of target: Protein transport. Probably involved in vesicular traffic.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 5.86 pg/mL
RAB5B, Member RAS Oncogene Family Protein
20-abx260830
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
Rab5b sgRNA CRISPR Lentivector set (Rat)
K6481401 3 x 1.0 ug
EUR 339
RAB5B sgRNA CRISPR Lentivector set (Human)
K1769501 3 x 1.0 ug
EUR 339
Rab5b sgRNA CRISPR Lentivector set (Mouse)
K4745601 3 x 1.0 ug
EUR 339
Rab5b Exo-Flow capture kit (Magnetic streptavidin beads, Rab5b-biotin capture antibody, Wash and Elution Buffers, Exo-FITC stain)
EXOFLOW500A-1 10 reactions
EUR 561
  • Category: Exosomes
Recombinant Human RAB5B, Member RAS Oncogene Family
7-05995 5µg Ask for price
Recombinant Human RAB5B, Member RAS Oncogene Family
7-05996 20µg Ask for price
Recombinant Human RAB5B, Member RAS Oncogene Family
7-05997 1mg Ask for price
Human Ras-related protein Rab-5B (RAB5B)
1-CSB-EP019214HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 50.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Ras-related protein Rab-5B(RAB5B) expressed in E.coli
Rab5b sgRNA CRISPR Lentivector (Rat) (Target 1)
K6481402 1.0 ug DNA
EUR 154
Rab5b sgRNA CRISPR Lentivector (Rat) (Target 2)
K6481403 1.0 ug DNA
EUR 154
Rab5b sgRNA CRISPR Lentivector (Rat) (Target 3)
K6481404 1.0 ug DNA
EUR 154
RAB5B sgRNA CRISPR Lentivector (Human) (Target 1)
K1769502 1.0 ug DNA
EUR 154
RAB5B sgRNA CRISPR Lentivector (Human) (Target 2)
K1769503 1.0 ug DNA
EUR 154
RAB5B sgRNA CRISPR Lentivector (Human) (Target 3)
K1769504 1.0 ug DNA
EUR 154
Rab5b sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4745602 1.0 ug DNA
EUR 154
Rab5b sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4745603 1.0 ug DNA
EUR 154
Rab5b sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4745604 1.0 ug DNA
EUR 154
RAB5B Protein Vector (Rat) (pPB-C-His)
PV297834 500 ng
EUR 603
RAB5B Protein Vector (Rat) (pPB-N-His)
PV297835 500 ng
EUR 603
RAB5B Protein Vector (Rat) (pPM-C-HA)
PV297836 500 ng
EUR 603
RAB5B Protein Vector (Rat) (pPM-C-His)
PV297837 500 ng
EUR 603
RAB5B Protein Vector (Human) (pPB-C-His)
PV056913 500 ng
EUR 481
RAB5B Protein Vector (Human) (pPB-N-His)
PV056914 500 ng
EUR 481
RAB5B Protein Vector (Human) (pPM-C-HA)
PV056915 500 ng
EUR 481
RAB5B Protein Vector (Human) (pPM-C-His)
PV056916 500 ng
EUR 481
RAB5B Protein Vector (Mouse) (pPB-C-His)
PV221810 500 ng
EUR 603
RAB5B Protein Vector (Mouse) (pPB-N-His)
PV221811 500 ng
EUR 603
RAB5B Protein Vector (Mouse) (pPM-C-HA)
PV221812 500 ng
EUR 603
RAB5B Protein Vector (Mouse) (pPM-C-His)
PV221813 500 ng
EUR 603
Rab5b 3'UTR Luciferase Stable Cell Line
TU117437 1.0 ml Ask for price
Rab5b 3'UTR GFP Stable Cell Line
TU167437 1.0 ml Ask for price
Rab5b 3'UTR Luciferase Stable Cell Line
TU217217 1.0 ml Ask for price
Rab5b 3'UTR GFP Stable Cell Line
TU267217 1.0 ml Ask for price

RAB5B Rabbit Polyclonal Antibody