October 17, 2021

TAF12 Rabbit Polyclonal Antibody

TAF12 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

TAF12 Polyclonal Antibody

ABP60607-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human TAF12 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TAF12 from Human, Mouse. This TAF12 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TAF12 protein

TAF12 Polyclonal Antibody

A56964 100 µg
EUR 570.55
Description: Ask the seller for details

TAF12 Rabbit pAb

A5421-100ul 100 ul
EUR 308

TAF12 Rabbit pAb

A5421-200ul 200 ul
EUR 459

TAF12 Rabbit pAb

A5421-20ul 20 ul
EUR 183

TAF12 Rabbit pAb

A5421-50ul 50 ul
EUR 223

TAF12 antibody

70R-20689 50 ul
EUR 435
Description: Rabbit polyclonal TAF12 antibody

TAF12 Antibody

40134-100ul 100ul
EUR 252

TAF12 antibody

10R-10398 100 ug
EUR 435
Description: Mouse monoclonal TAF12 antibody

TAF12 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TAF12. Recognizes TAF12 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

TAF12 Antibody

DF12175 200ul
EUR 304
Description: TAF12 antibody detects endogenous levels of TAF12.

TAF12 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against TAF12. Recognizes TAF12 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

TAF12 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TAF12. Recognizes TAF12 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

TAF12 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TAF12. Recognizes TAF12 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

TAF12 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TAF12. Recognizes TAF12 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

TAF12 Polyclonal Antibody, HRP Conjugated

A56965 100 µg
EUR 570.55
Description: The best epigenetics products

TAF12 Polyclonal Antibody, FITC Conjugated

A56966 100 µg
EUR 570.55
Description: kits suitable for this type of research

TAF12 Polyclonal Antibody, Biotin Conjugated

A56967 100 µg
EUR 570.55
Description: fast delivery possible

Mouse TATA Box Binding Protein Associated Factor 12 (TAF12) ELISA Kit

DLR-TAF12-Mu-48T 48T
EUR 527
  • Should the Mouse TATA Box Binding Protein Associated Factor 12 (TAF12) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse TATA Box Binding Protein Associated Factor 12 (TAF12) in samples from tissue homogenates or other biological fluids.

Mouse TATA Box Binding Protein Associated Factor 12 (TAF12) ELISA Kit

DLR-TAF12-Mu-96T 96T
EUR 688
  • Should the Mouse TATA Box Binding Protein Associated Factor 12 (TAF12) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse TATA Box Binding Protein Associated Factor 12 (TAF12) in samples from tissue homogenates or other biological fluids.

Mouse TATA Box Binding Protein Associated Factor 12 (TAF12) ELISA Kit

RD-TAF12-Mu-48Tests 48 Tests
EUR 533

Mouse TATA Box Binding Protein Associated Factor 12 (TAF12) ELISA Kit

RD-TAF12-Mu-96Tests 96 Tests
EUR 740

Mouse TATA Box Binding Protein Associated Factor 12 (TAF12) ELISA Kit

RDR-TAF12-Mu-48Tests 48 Tests
EUR 557

Mouse TATA Box Binding Protein Associated Factor 12 (TAF12) ELISA Kit

RDR-TAF12-Mu-96Tests 96 Tests
EUR 774

[KO Validated] TAF12 Rabbit pAb

A18073-100ul 100 ul
EUR 410

[KO Validated] TAF12 Rabbit pAb

A18073-200ul 200 ul
EUR 571

[KO Validated] TAF12 Rabbit pAb

A18073-20ul 20 ul
EUR 221

[KO Validated] TAF12 Rabbit pAb

A18073-50ul 50 ul
EUR 287

TAF12 Conjugated Antibody

C40134 100ul
EUR 397

anti- TAF12 antibody

FNab08478 100µg
EUR 548.75
  • Immunogen: TAF12 RNA polymerase II, TATA box binding protein(TBP)-associated factor, 20kDa
  • Uniprot ID: Q16514
  • Gene ID: 6883
  • Research Area: Metabolism
Description: Antibody raised against TAF12

Anti-TAF12 Antibody

A06944-1 100ug/vial
EUR 334

Anti-TAF12 antibody

PAab08478 100 ug
EUR 386

Anti-TAF12 antibody

STJ11100046 100 µl
EUR 413
Description: Control of transcription by RNA polymerase II involves the basal transcription machinery which is a collection of proteins. These proteins with RNA polymerase II, assemble into complexes which are modulated by transactivator proteins that bind to cis-regulatory elements located adjacent to the transcription start site. Some modulators interact directly with the basal complex, whereas others may act as bridging proteins linking transactivators to the basal transcription factors. Some of these associated factors are weakly attached while others are tightly associated with TBP in the TFIID complex. Among the latter are the TAF proteins. Different TAFs are predicted to mediate the function of distinct transcriptional activators for a variety of gene promoters and RNA polymerases. TAF12 interacts directly with TBP as well as with TAF2I. Two transcript variants encoding the same protein have been found for this gene.

Anti-TAF12 antibody

STJ27374 100 µl
EUR 277
Description: Control of transcription by RNA polymerase II involves the basal transcription machinery which is a collection of proteins. These proteins with RNA polymerase II, assemble into complexes which are modulated by transactivator proteins that bind to cis-regulatory elements located adjacent to the transcription start site. Some modulators interact directly with the basal complex, whereas others may act as bridging proteins linking transactivators to the basal transcription factors. Some of these associated factors are weakly attached while others are tightly associated with TBP in the TFIID complex. Among the latter are the TAF proteins. Different TAFs are predicted to mediate the function of distinct transcriptional activators for a variety of gene promoters and RNA polymerases. TAF12 interacts directly with TBP as well as with TAF2I. Two transcript variants encoding the same protein have been found for this gene.

Anti-TAF12 antibody

STJ191537 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TAF12


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA14903 50 ul
EUR 363
Description: Mouse polyclonal to TAF12


YF-PA14904 50 ug
EUR 363
Description: Mouse polyclonal to TAF12

TAF12 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TAF12. Recognizes TAF12 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TAF12 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TAF12. Recognizes TAF12 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TAF12 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TAF12. Recognizes TAF12 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

TAF12 Blocking Peptide

DF12175-BP 1mg
EUR 195

TAF12 cloning plasmid

CSB-CL624102HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 486
  • Sequence: atgaaccagtttggcccctcagccctaatcaacctctccaatttctcatccataaaaccggaaccagccagcacccctccacaaggctccatggccaatagtactgcagtggtaaagataccaggcactcctggggcaggaggtcgtcttagccctgaaaacaatcaggtattgac
  • Show more
Description: A cloning plasmid for the TAF12 gene.

Anti-TAF12 (1E10)

YF-MA15714 100 ug
EUR 363
Description: Mouse monoclonal to TAF12

Mouse TAF12 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF003432 96 Tests
EUR 689


ELI-46614b 96 Tests
EUR 928


ELI-41687h 96 Tests
EUR 824

Mouse Taf12 ELISA KIT

ELI-41741m 96 Tests
EUR 865

Human TAF12 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TAF12 Recombinant Protein (Human)

RP030844 100 ug Ask for price

TAF12 Recombinant Protein (Rat)

RP232148 100 ug Ask for price

TAF12 Recombinant Protein (Mouse)

RP177080 100 ug Ask for price

TATA Box Binding Protein Associated Factor 12 (TAF12) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TAF12 (Met1~Lys161)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human TATA Box Binding Protein Associated Factor 12 (TAF12)

Taf12 ORF Vector (Mouse) (pORF)

ORF059028 1.0 ug DNA
EUR 506

TAF12 ORF Vector (Human) (pORF)

ORF010282 1.0 ug DNA
EUR 95

Taf12 ORF Vector (Rat) (pORF)

ORF077384 1.0 ug DNA
EUR 506

TAF12 ELISA Kit (Mouse) (OKDD00649)

OKDD00649 96 Wells
EUR 988
Description: Description of target: Tafs are components of the transcription factor iid (tfiid) complex, pcaf histone acetylase complex and tbp-free tafii complex (tftc). tafs components-tiifd are essential for mediating regulation of rna polymerase transcription (by similarity).;Species reactivity: Mouse;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.059 ng/mL

TATA Box Binding Protein Associated Factor 12 (TAF12) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TAF12 (Met1~Lys161)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human TATA Box Binding Protein Associated Factor 12 (TAF12). This antibody is labeled with APC.

TATA Box Binding Protein Associated Factor 12 (TAF12) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TAF12 (Met1~Lys161)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human TATA Box Binding Protein Associated Factor 12 (TAF12). This antibody is labeled with Biotin.

TATA Box Binding Protein Associated Factor 12 (TAF12) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TAF12 (Met1~Lys161)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human TATA Box Binding Protein Associated Factor 12 (TAF12). This antibody is labeled with Cy3.

TATA Box Binding Protein Associated Factor 12 (TAF12) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TAF12 (Met1~Lys161)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human TATA Box Binding Protein Associated Factor 12 (TAF12). This antibody is labeled with FITC.

TATA Box Binding Protein Associated Factor 12 (TAF12) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TAF12 (Met1~Lys161)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human TATA Box Binding Protein Associated Factor 12 (TAF12). This antibody is labeled with HRP.

TATA Box Binding Protein Associated Factor 12 (TAF12) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TAF12 (Met1~Lys161)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human TATA Box Binding Protein Associated Factor 12 (TAF12). This antibody is labeled with PE.

TAF12 sgRNA CRISPR Lentivector set (Human)

K2329601 3 x 1.0 ug
EUR 339

Taf12 sgRNA CRISPR Lentivector set (Mouse)

K4589101 3 x 1.0 ug
EUR 339

Taf12 sgRNA CRISPR Lentivector set (Rat)

K6649001 3 x 1.0 ug
EUR 339

TATA Box Binding Protein Associated Factor 12 (TAF12) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TAF12 (Met1~Lys161)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human TATA Box Binding Protein Associated Factor 12 (TAF12). This antibody is labeled with APC-Cy7.

TATA Box Binding Protein Associated Factor 12 (TAF12) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

TATA Box Binding Protein Associated Factor 12 (TAF12) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

TATA Box Binding Protein Associated Factor 12 (TAF12) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

TATA Box Binding Protein Associated Factor 12 (TAF12) Antibody

abx018184-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.

TATA Box Binding Protein Associated Factor 12 (TAF12) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

TATA Box Binding Protein Associated Factor 12 (TAF12) Antibody

abx238478-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

TATA Box Binding Protein Associated Factor 12 (TAF12) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

TATA Box Binding Protein Associated Factor 12 (TAF12) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

TATA Box Binding Protein Associated Factor 12 (TAF12) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

TATA Box Binding Protein Associated Factor 12 (TAF12) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

TATA Box Binding Protein Associated Factor 12 (TAF12) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

TAF12 sgRNA CRISPR Lentivector (Human) (Target 1)

K2329602 1.0 ug DNA
EUR 154

TAF12 sgRNA CRISPR Lentivector (Human) (Target 2)

K2329603 1.0 ug DNA
EUR 154

TAF12 sgRNA CRISPR Lentivector (Human) (Target 3)

K2329604 1.0 ug DNA
EUR 154

Taf12 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4589102 1.0 ug DNA
EUR 154

Taf12 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4589103 1.0 ug DNA
EUR 154

Taf12 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4589104 1.0 ug DNA
EUR 154

Taf12 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6649002 1.0 ug DNA
EUR 154

Taf12 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6649003 1.0 ug DNA
EUR 154

Taf12 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6649004 1.0 ug DNA
EUR 154

TAF12 Protein Vector (Human) (pPB-C-His)

PV041125 500 ng
EUR 329

TAF12 Protein Vector (Human) (pPB-N-His)

PV041126 500 ng
EUR 329

TAF12 Protein Vector (Human) (pPM-C-HA)

PV041127 500 ng
EUR 329

TAF12 Protein Vector (Human) (pPM-C-His)

PV041128 500 ng
EUR 329

TAF12 Protein Vector (Rat) (pPB-C-His)

PV309534 500 ng
EUR 603

TAF12 Protein Vector (Rat) (pPB-N-His)

PV309535 500 ng
EUR 603

TAF12 Protein Vector (Rat) (pPM-C-HA)

PV309536 500 ng
EUR 603

TAF12 Protein Vector (Rat) (pPM-C-His)

PV309537 500 ng
EUR 603

TAF12 Protein Vector (Mouse) (pPB-C-His)

PV236110 500 ng
EUR 603

TAF12 Protein Vector (Mouse) (pPB-N-His)

PV236111 500 ng
EUR 603

TAF12 Protein Vector (Mouse) (pPM-C-HA)

PV236112 500 ng
EUR 603

TAF12 Protein Vector (Mouse) (pPM-C-His)

PV236113 500 ng
EUR 603

Taf12 3'UTR GFP Stable Cell Line

TU170096 1.0 ml Ask for price

Taf12 3'UTR Luciferase Stable Cell Line

TU120096 1.0 ml Ask for price

TAF12 3'UTR GFP Stable Cell Line

TU075101 1.0 ml
EUR 1394

TAF12 3'UTR Luciferase Stable Cell Line

TU025101 1.0 ml
EUR 1394

Taf12 3'UTR Luciferase Stable Cell Line

TU221541 1.0 ml Ask for price

Taf12 3'UTR GFP Stable Cell Line

TU271541 1.0 ml Ask for price

TATA Box Binding Protein Associated Factor 12 (TAF12) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

TATA Box Binding Protein Associated Factor 12 (TAF12) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

TATA Box Binding Protein Associated Factor 12 (TAF12) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

TAF12 Rabbit Polyclonal Antibody