NLK Rabbit Polyclonal Antibody
To Order Contact us: [email protected]
 NLK Polyclonal Antibody |
|
ES10199-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NLK from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 NLK Rabbit pAb |
|
A3190-100ul |
Abclonal |
100 ul |
EUR 308 |
NLK Rabbit pAb |
|
A3190-200ul |
Abclonal |
200 ul |
EUR 459 |
NLK Rabbit pAb |
|
A3190-20ul |
Abclonal |
20 ul |
EUR 183 |
NLK Rabbit pAb |
|
A3190-50ul |
Abclonal |
50 ul |
EUR 223 |
 NLK antibody |
|
23128-100ul |
SAB |
100ul |
EUR 390 |
NLK antibody |
|
70R-13123 |
Fitzgerald |
100 ul |
EUR 457 |
|
Description: Affinity purified Rabbit polyclonal NLK antibody |
NLK antibody |
|
38629-100ul |
SAB |
100ul |
EUR 252 |
 NLK Antibody |
|
1-CSB-PA890657ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against NLK. Recognizes NLK from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
NLK Antibody |
|
1-CSB-PA890657ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against NLK. Recognizes NLK from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
 NLK Antibody |
|
DF7243 |
Affbiotech |
200ul |
EUR 304 |
|
Description: NLK Antibody detects endogenous levels of total NLK. |
NLK Antibody |
|
DF7575 |
Affbiotech |
200ul |
EUR 304 |
|
Description: NLK Antibody detects endogenous levels of total NLK. |
NLK antibody |
|
70R-9450 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Affinity purified rabbit polyclonal NLK antibody |
) Polyclonal NLK Antibody (C-term) |
|
APR17584G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NLK (C-term). This antibody is tested and proven to work in the following applications: |
 Antibody) Serine/threonine-Protein Kinase NLK (NLK) Antibody |
|
20-abx125032 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Serine/threonine-Protein Kinase NLK (NLK) Antibody |
|
abx033464-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Serine/threonine-Protein Kinase NLK (NLK) Antibody |
|
abx033464-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Serine/threonine-Protein Kinase NLK (NLK) Antibody |
|
abx034924-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Serine/threonine-Protein Kinase NLK (NLK) Antibody |
|
abx034924-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Serine/threonine-Protein Kinase NLK (NLK) Antibody |
|
20-abx320761 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Serine/threonine-Protein Kinase NLK (NLK) Antibody |
|
20-abx321819 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Serine/threonine-Protein Kinase NLK (NLK) Antibody |
|
20-abx002290 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
 NLK-T286 Antibody |
|
abx033465-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
NLK-T286 Antibody |
|
abx033465-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
 Monoclonal NLK Antibody |
|
APR17825G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A Monoclonal antibody against Human NLK. The antibodies are raised in Mouse. This antibody is applicable in WB |
 NLK Conjugated Antibody |
|
C38629 |
SAB |
100ul |
EUR 397 |
 Anti-NLK antibody |
|
STJ191357 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to NLK |
 NLK siRNA |
|
20-abx903574 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NLK siRNA |
|
20-abx926002 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NLK siRNA |
|
20-abx926003 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-NLK |
|
YF-PA19168 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to NLK |
anti-NLK |
|
YF-PA26210 |
Abfrontier |
50 ul |
EUR 334 |
|
Description: Mouse polyclonal to NLK |
 NLK Blocking Peptide |
|
33R-8051 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NLK antibody, catalog no. 70R-9450 |
NLK Blocking Peptide |
|
DF7243-BP |
Affbiotech |
1mg |
EUR 195 |
NLK Blocking Peptide |
|
DF7575-BP |
Affbiotech |
1mg |
EUR 195 |
 NLK cloning plasmid |
|
CSB-CL890657HU-10ug |
Cusabio |
10ug |
EUR 544 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1548
- Sequence: atggcggcttacaatggcggtacatctgcagcagcaacaggtcaccaccaccaccatcaccaccaccttccacacctccctcctcctcacctgcaccaccaccaccaccctcaacaccatcttcatccggggtcggctgccgctgtacaccctgtacagcagcacacctcttcgg
- Show more
|
|
Description: A cloning plasmid for the NLK gene. |
) Anti-NLK (1C1) |
|
YF-MA18555 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to NLK |
) Anti-NLK (2B11) |
|
YF-MA18556 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to NLK |
 Monoclonal NLK Antibody, Clone: 1146CT24.2.1 |
|
APR17583G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A Monoclonal antibody against Human NLK. The antibodies are raised in Mouse and are from clone 1146CT24.2.1. This antibody is applicable in WB, E |
 Mouse Serine/threonine- protein kinase NLK, Nlk ELISA KIT |
|
ELI-15096m |
Lifescience Market |
96 Tests |
EUR 865 |
 Human Serine/threonine- protein kinase NLK, NLK ELISA KIT |
|
ELI-44037h |
Lifescience Market |
96 Tests |
EUR 824 |
 ELISA Kit) Rat Serine/threonine-protein kinase NLK (NLK) ELISA Kit |
|
abx391676-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Human Serine/threonine-protein kinase NLK (NLK) ELISA Kit |
|
abx385203-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Mouse Serine/threonine-protein kinase NLK (NLK) ELISA Kit |
|
abx390000-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 Bovine Serine/threonine- protein kinase NLK, NLK ELISA KIT |
|
ELI-38287b |
Lifescience Market |
96 Tests |
EUR 928 |
 Nlk ELISA Kit| Mouse Serine/threonine-protein kinase NLK ELISA |
|
EF015639 |
Lifescience Market |
96 Tests |
EUR 689 |
 NLK ELISA Kit| Bovine Serine/threonine-protein kinase NLK ELISA |
|
EF011651 |
Lifescience Market |
96 Tests |
EUR 689 |
 Rat NLK shRNA Plasmid |
|
20-abx990833 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse NLK shRNA Plasmid |
|
20-abx971760 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human NLK shRNA Plasmid |
|
20-abx959907 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Nlk ELISA Kit| Rat Serine/threonine-protein kinase NLK ELISA Ki |
|
EF019036 |
Lifescience Market |
96 Tests |
EUR 689 |
 (pORF)) Nlk ORF Vector (Rat) (pORF) |
|
ORF071352 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) NLK ORF Vector (Human) (pORF) |
|
ORF007104 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Nlk ORF Vector (Mouse) (pORF) |
|
ORF051433 |
ABM |
1.0 ug DNA |
EUR 506 |
) Nlk sgRNA CRISPR Lentivector set (Mouse) |
|
K4852401 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Nlk sgRNA CRISPR Lentivector set (Rat) |
|
K6643801 |
ABM |
3 x 1.0 ug |
EUR 339 |
) NLK sgRNA CRISPR Lentivector set (Human) |
|
K1432801 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) Nlk sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4852402 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Nlk sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4852403 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Nlk sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4852404 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Nlk sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6643802 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Nlk sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6643803 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Nlk sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6643804 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) NLK sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K1432802 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) NLK sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K1432803 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) NLK sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K1432804 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) NLK Protein Vector (Mouse) (pPB-C-His) |
|
PV205730 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) NLK Protein Vector (Mouse) (pPB-N-His) |
|
PV205731 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) NLK Protein Vector (Mouse) (pPM-C-HA) |
|
PV205732 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) NLK Protein Vector (Mouse) (pPM-C-His) |
|
PV205733 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) NLK Protein Vector (Rat) (pPB-C-His) |
|
PV285406 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) NLK Protein Vector (Rat) (pPB-N-His) |
|
PV285407 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) NLK Protein Vector (Rat) (pPM-C-HA) |
|
PV285408 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) NLK Protein Vector (Rat) (pPM-C-His) |
|
PV285409 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) NLK Protein Vector (Human) (pPB-C-His) |
|
PV028413 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) NLK Protein Vector (Human) (pPB-N-His) |
|
PV028414 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) NLK Protein Vector (Human) (pPM-C-HA) |
|
PV028415 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) NLK Protein Vector (Human) (pPM-C-His) |
|
PV028416 |
ABM |
500 ng |
EUR 329 |
 Nlk 3'UTR Luciferase Stable Cell Line |
|
TU114136 |
ABM |
1.0 ml |
Ask for price |
 Nlk 3'UTR GFP Stable Cell Line |
|
TU164136 |
ABM |
1.0 ml |
Ask for price |
Nlk 3'UTR Luciferase Stable Cell Line |
|
TU214021 |
ABM |
1.0 ml |
Ask for price |
Nlk 3'UTR GFP Stable Cell Line |
|
TU264021 |
ABM |
1.0 ml |
Ask for price |
 NLK 3'UTR GFP Stable Cell Line |
|
TU065741 |
ABM |
1.0 ml |
EUR 1521 |
 NLK 3'UTR Luciferase Stable Cell Line |
|
TU015741 |
ABM |
1.0 ml |
EUR 1521 |
 (CMV) (pLenti-GIII-CMV)) NLK Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV668677 |
ABM |
1.0 ug DNA |
EUR 682 |
 (UbC) (pLenti-GIII-UbC)) NLK Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV668681 |
ABM |
1.0 ug DNA |
EUR 682 |
 (EF1a) (pLenti-GIII-EF1a)) NLK Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV668682 |
ABM |
1.0 ug DNA |
EUR 682 |
 (UbC) (pLenti-GIII-UbC)) NLK Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
|
LV792181 |
ABM |
1.0 ug DNA |
EUR 316 |
 (EF1a) (pLenti-GIII-EF1a)) NLK Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
|
LV792182 |
ABM |
1.0 ug DNA |
EUR 316 |
 GAPDH Rabbit Polyclonal Antibody |
|
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
|
37985-50ul |
SAB |
50ul |
EUR 187 |
 EFHD1 Rabbit Polyclonal Antibody |
|
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
|
38001-50ul |
SAB |
50ul |
EUR 187 |
 Alliinase Rabbit Polyclonal Antibody |
|
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
|
38042-50ul |
SAB |
50ul |
EUR 187 |
 ECFP Rabbit Polyclonal Antibody |
|
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
|
38077-50ul |
SAB |
50ul |
EUR 187 |
 EYFP Rabbit Polyclonal Antibody |
|
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
|
38078-50ul |
SAB |
50ul |
EUR 187 |
 mOrange Rabbit Polyclonal Antibody |
|
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
|
38079-50ul |
SAB |
50ul |
EUR 187 |
 mStrawberry Rabbit Polyclonal Antibody |
|
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
|
38083-50ul |
SAB |
50ul |
EUR 187 |
 AmCyan Rabbit Polyclonal Antibody |
|
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
|
38086-50ul |
SAB |
50ul |
EUR 187 |
 EBFP Rabbit Polyclonal Antibody |
|
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
|
38087-50ul |
SAB |
50ul |
EUR 187 |
 Vimentin Rabbit Polyclonal Antibody |
|
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
|
38104-50ul |
SAB |
50ul |
EUR 187 |
 LDHD Rabbit Polyclonal Antibody |
|
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
|
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
 Rabbit Hemoglobin Polyclonal Antibody |
|
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
 VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
 CD10 Rabbit Polyclonal Antibody |
|
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
 NM23A Rabbit Polyclonal Antibody |
|
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
 ATM Rabbit Polyclonal Antibody |
|
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
 HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
 HSP40 Rabbit Polyclonal Antibody |
|
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
|
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
|
ABP57566-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
 HSP90Alpha Rabbit Polyclonal Antibody |
|
ABP57567-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
|
ABP57567-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
|
ABP57567-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
 JAK1 Rabbit Polyclonal Antibody |
|
ABP57569-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
|
ABP57569-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
|
ABP57569-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
 JAK2 Rabbit Polyclonal Antibody |
|
ABP57570-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
|
ABP57570-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
|
ABP57570-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
 JNK2 Rabbit Polyclonal Antibody |
|
ABP57571-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
|
ABP57571-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
|
ABP57571-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
NLK Rabbit Polyclonal Antibody
