October 28, 2021

RBBP6 Rabbit Polyclonal Antibody

RBBP6 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

RBBP6 Polyclonal Antibody
ABP60112-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human RBBP6 protein at amino acid sequence of 270-350
  • Applications tips:
Description: A polyclonal antibody for detection of RBBP6 from Human, Mouse. This RBBP6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RBBP6 protein at amino acid sequence of 270-350

RBBP6 Polyclonal Antibody
ABP60112-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RBBP6 protein at amino acid sequence of 270-350
  • Applications tips:
Description: A polyclonal antibody for detection of RBBP6 from Human, Mouse. This RBBP6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RBBP6 protein at amino acid sequence of 270-350

RBBP6 Polyclonal Antibody
ABP60112-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RBBP6 protein at amino acid sequence of 270-350
  • Applications tips:
Description: A polyclonal antibody for detection of RBBP6 from Human, Mouse. This RBBP6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RBBP6 protein at amino acid sequence of 270-350

RBBP6 Polyclonal Antibody
ES10156-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RBBP6 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

RBBP6 Polyclonal Antibody
ES10156-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RBBP6 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

RBBP6 Rabbit pAb
A14776-100ul 100 ul
EUR 308

RBBP6 Rabbit pAb
A14776-200ul 200 ul
EUR 459

RBBP6 Rabbit pAb
A14776-20ul 20 ul
EUR 183

RBBP6 Rabbit pAb
A14776-50ul 50 ul
EUR 223

RBBP6 Rabbit pAb
A6966-100ul 100 ul
EUR 308

RBBP6 Rabbit pAb
A6966-200ul 200 ul
EUR 459

RBBP6 Rabbit pAb
A6966-20ul 20 ul
EUR 183

RBBP6 Rabbit pAb
A6966-50ul 50 ul
EUR 223

RBBP6 Polyclonal Conjugated Antibody
C28700 100ul
EUR 397

RBBP6 Polyclonal Conjugated Antibody
C30775 100ul
EUR 397

RBBP6 antibody
70R-19797 50 ul
EUR 435
Description: Rabbit polyclonal RBBP6 antibody

RBBP6 Antibody
39226-100ul 100ul
EUR 390

RBBP6 Antibody
39408-100ul 100ul
EUR 390

RBBP6 Antibody
1-CSB-PA768776LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RBBP6. Recognizes RBBP6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

RBBP6 Antibody
DF9853 200ul
EUR 304
Description: RBBP6 Antibody detects endogenous levels of total RBBP6.

RBBP6 antibody
70R-51322 100 ul
EUR 244
Description: Purified Polyclonal RBBP6 antibody

RBBP6 antibody
70R-5583 50 ug
EUR 467
Description: Rabbit polyclonal RBBP6 antibody raised against the N terminal of RBBP6

RBBP6 Antibody
1-CSB-PA019391GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RBBP6. Recognizes RBBP6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RBBP6 Antibody
ABD9853 100 ug
EUR 438

Histone-Binding Protein RBBP6 (RBBP6) Antibody
20-abx007831
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Histone-Binding Protein RBBP6 (RBBP6) Antibody
20-abx005285
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Histone-Binding Protein RBBP6 (RBBP6) Antibody
abx038306-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Histone-Binding Protein RBBP6 (RBBP6) Antibody
abx038417-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Histone-Binding Protein RBBP6 (RBBP6) Antibody
abx038470-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Histone-Binding Protein RBBP6 (RBBP6) Antibody
abx237152-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Histone-Binding Protein RBBP6 (RBBP6) Antibody
20-abx318256
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Histone-Binding Protein RBBP6 (RBBP6) Antibody (HRP)
20-abx316343
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Histone-Binding Protein RBBP6 (RBBP6) Antibody (FITC)
20-abx316344
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Histone-Binding Protein RBBP6 (RBBP6) Antibody (Biotin)
20-abx316345
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Polyclonal RBBP6 antibody - N-terminal region
APR00874G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RBBP6 - N-terminal region. This antibody is tested and proven to work in the following applications:

anti- RBBP6 antibody
FNab07152 100µg
EUR 548.75
  • Immunogen: retinoblastoma binding protein 6
  • Uniprot ID: Q7Z6E9
  • Gene ID: 5930
  • Research Area: Epigenetics, Immunology, Metabolism
Description: Antibody raised against RBBP6

Anti-RBBP6 antibody
PAab07152 100 ug
EUR 386

Anti-RBBP6 antibody
STJ29046 100 µl
EUR 277
Description: The retinoblastoma tumor suppressor (pRB) protein binds with many other proteins. In various human cancers, pRB suppresses cellular proliferation and is inactivated. Cell cycle-dependent phosphorylation regulates the activity of pRB. This gene encodes a protein which binds to underphosphorylated but not phosphorylated pRB. Multiple alternatively spliced transcript variants that encode different isoforms have been found for this gene.

Anti-RBBP6 antibody
STJ116976 100 µl
EUR 277
Description: The retinoblastoma tumor suppressor (pRB) protein binds with many other proteins. In various human cancers, pRB suppresses cellular proliferation and is inactivated. Cell cycle-dependent phosphorylation regulates the activity of pRB. This gene encodes a protein which binds to underphosphorylated but not phosphorylated pRB. Multiple alternatively spliced transcript variants that encode different isoforms have been found for this gene.

Anti-RBBP6 antibody
STJ191314 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RBBP6

RBBP6 siRNA
20-abx930999
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RBBP6 siRNA
20-abx931000
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RBBP6 Antibody, HRP conjugated
1-CSB-PA768776LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RBBP6. Recognizes RBBP6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RBBP6 Antibody, FITC conjugated
1-CSB-PA768776LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RBBP6. Recognizes RBBP6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RBBP6 Antibody, Biotin conjugated
1-CSB-PA768776LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RBBP6. Recognizes RBBP6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human Histone-binding protein RBBP6 (RBBP6) ELISA Kit
abx382708-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

RBBP6 Blocking Peptide
33R-1433 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RBBP6 antibody, catalog no. 70R-5583

RBBP6 Blocking Peptide
DF9853-BP 1mg
EUR 195

RBBP6 Blocking Peptide
20-abx064197
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

RBBP6 cloning plasmid
CSB-CL768776HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 357
  • Sequence: atgtcctgtgtgcattataaattttcctctaaactcaactatgataccgtcacctttgatgggctccacatctccctctgcgacttaaagaagcagattatggggagagagaagctgaaagctgccgactgcgacctgcagatcaccaatgcgcagacgaaagaagaatatactga
  • Show more
Description: A cloning plasmid for the RBBP6 gene.

Mouse E3 ubiquitin- protein ligase RBBP6, Rbbp6 ELISA KIT
ELI-36000m 96 Tests
EUR 865

Human E3 ubiquitin- protein ligase RBBP6, RBBP6 ELISA KIT
ELI-36042h 96 Tests
EUR 824

RBBP6 ELISA KIT|Human
EF002342 96 Tests
EUR 689

Mouse RBBP6 shRNA Plasmid
20-abx972397
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RBBP6 shRNA Plasmid
20-abx954016
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Retinoblastoma Binding Protein 6 (RBBP6) Antibody
20-abx115149
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Monoclonal RBBP6 Antibody (monoclonal) (M01), Clone: 5A11
AMM03998G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human RBBP6 (monoclonal) (M01). The antibodies are raised in Mouse and are from clone 5A11. This antibody is applicable in WB, IHC and IF, E

RBBP6 ORF Vector (Human) (pORF)
ORF008623 1.0 ug DNA
EUR 95

Rbbp6 ORF Vector (Mouse) (pORF)
ORF055675 1.0 ug DNA
EUR 506

Rbbp6 ORF Vector (Mouse) (pORF)
ORF055676 1.0 ug DNA
EUR 1572

RBBP6 sgRNA CRISPR Lentivector set (Human)
K1791601 3 x 1.0 ug
EUR 339

Rbbp6 sgRNA CRISPR Lentivector set (Mouse)
K4005701 3 x 1.0 ug
EUR 339

RBBP6 sgRNA CRISPR Lentivector (Human) (Target 1)
K1791602 1.0 ug DNA
EUR 154

RBBP6 sgRNA CRISPR Lentivector (Human) (Target 2)
K1791603 1.0 ug DNA
EUR 154

RBBP6 sgRNA CRISPR Lentivector (Human) (Target 3)
K1791604 1.0 ug DNA
EUR 154

Rbbp6 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4005702 1.0 ug DNA
EUR 154

Rbbp6 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4005703 1.0 ug DNA
EUR 154

Rbbp6 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4005704 1.0 ug DNA
EUR 154

RBBP6 Protein Vector (Human) (pPB-C-His)
PV034489 500 ng
EUR 329

RBBP6 Protein Vector (Human) (pPB-N-His)
PV034490 500 ng
EUR 329

RBBP6 Protein Vector (Human) (pPM-C-HA)
PV034491 500 ng
EUR 329

RBBP6 Protein Vector (Human) (pPM-C-His)
PV034492 500 ng
EUR 329

RBBP6 Protein Vector (Mouse) (pPB-C-His)
PV222698 500 ng
EUR 603

RBBP6 Protein Vector (Mouse) (pPB-N-His)
PV222699 500 ng
EUR 603

RBBP6 Protein Vector (Mouse) (pPM-C-HA)
PV222700 500 ng
EUR 603

RBBP6 Protein Vector (Mouse) (pPM-C-His)
PV222701 500 ng
EUR 603

RBBP6 Protein Vector (Mouse) (pPB-C-His)
PV222702 500 ng
EUR 2979

RBBP6 Protein Vector (Mouse) (pPB-N-His)
PV222703 500 ng
EUR 2979

RBBP6 Protein Vector (Mouse) (pPM-C-HA)
PV222704 500 ng
EUR 2979

RBBP6 Protein Vector (Mouse) (pPM-C-His)
PV222705 500 ng
EUR 2979

Rbbp6 3'UTR Luciferase Stable Cell Line
TU117591 1.0 ml Ask for price

Rbbp6 3'UTR GFP Stable Cell Line
TU167591 1.0 ml Ask for price

Rbbp6 3'UTR Luciferase Stable Cell Line
TU217360 1.0 ml Ask for price

Rbbp6 3'UTR GFP Stable Cell Line
TU267360 1.0 ml Ask for price

RBBP6 3'UTR GFP Stable Cell Line
TU069571 1.0 ml
EUR 1394

RBBP6 3'UTR Luciferase Stable Cell Line
TU019571 1.0 ml
EUR 1394

GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187

RBBP6 Rabbit Polyclonal Antibody