October 23, 2021

SYT12 Rabbit Polyclonal Antibody

SYT12 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

SYT12 Polyclonal Antibody

ABP60571-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human SYT12 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SYT12 from Human, Mouse, Rat. This SYT12 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SYT12 protein

SYT12 Polyclonal Antibody

ABP60571-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human SYT12 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SYT12 from Human, Mouse, Rat. This SYT12 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SYT12 protein

SYT12 Polyclonal Antibody

ABP60571-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human SYT12 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SYT12 from Human, Mouse, Rat. This SYT12 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SYT12 protein

SYT12 antibody

70R-20675 50 ul
EUR 435
Description: Rabbit polyclonal SYT12 antibody

SYT12 antibody

70R-9795 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal SYT12 antibody

SYT12 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SYT12. Recognizes SYT12 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Polyclonal SYT12 antibody - N-terminal region

APR13657G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SYT12 - N-terminal region. This antibody is tested and proven to work in the following applications:

Syt12/ Rat Syt12 ELISA Kit

ELI-18748r 96 Tests
EUR 886

Anti-SYT12 antibody

STJ191489 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SYT12


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Synaptotagmin Xii (SYT12) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Synaptotagmin 12 (SYT12) Antibody

abx145664-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Synaptotagmin-12 (Syt12) Antibody

abx445048-100ug 100 ug
EUR 523
  • Shipped within 5-12 working days.

Synaptotagmin-12 (Syt12) Antibody

abx238427-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

SYT12 Blocking Peptide

33R-1114 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NOL3 antibody, catalog no. 70R-10531

SYT12 cloning plasmid

CSB-CL818232HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1266
  • Sequence: atggctgtggatgtggcagaataccatctgagcgtcatcaagagcccccctggctgggaggtgggtgtctatgctgcaggggccctggccctgctgggaatcgcagctgtgagcctgtggaagctctggacgtcggggagcttccccagcccctctccgttccccaattacgact
  • Show more
Description: A cloning plasmid for the SYT12 gene.

Synaptotagmin-12 (Syt12) Antibody (ALP)

abx442445-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-12 (Syt12) Antibody (APC)

abx442726-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-12 (Syt12) Antibody (Biotin)

abx443006-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-12 (Syt12) Antibody (FITC)

abx443286-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.

Synaptotagmin-12 (Syt12) Antibody (HRP)

abx443567-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.

Synaptotagmin-12 (Syt12) Antibody (PerCP)

abx444129-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-12 (Syt12) Antibody (RPE)

abx444410-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-12 (Syt12) Antibody (Streptavidin)

abx444691-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Mouse SYT12 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat SYT12 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SYT12 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SYT12 Recombinant Protein (Human)

RP030772 100 ug Ask for price

SYT12 Recombinant Protein (Rat)

RP231971 100 ug Ask for price

SYT12 Recombinant Protein (Mouse)

RP176858 100 ug Ask for price

Synaptotagmin-12 (Syt12) Antibody (ATTO 390)

abx440197-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-12 (Syt12) Antibody (ATTO 488)

abx440478-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-12 (Syt12) Antibody (ATTO 565)

abx440759-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-12 (Syt12) Antibody (ATTO 594)

abx441040-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-12 (Syt12) Antibody (ATTO 633)

abx441321-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-12 (Syt12) Antibody (ATTO 655)

abx441602-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-12 (Syt12) Antibody (ATTO 680)

abx441883-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-12 (Syt12) Antibody (ATTO 700)

abx442164-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-12 (Syt12) Antibody (PE/ATTO 594)

abx443848-100ug 100 ug
EUR 592
  • Shipped within 5-12 working days.

Syt12 ORF Vector (Mouse) (pORF)

ORF058954 1.0 ug DNA
EUR 506

SYT12 ORF Vector (Human) (pORF)

ORF010258 1.0 ug DNA
EUR 95

Syt12 ORF Vector (Rat) (pORF)

ORF077325 1.0 ug DNA
EUR 506

Human Synaptotagmin- 12, SYT12 ELISA KIT

ELI-19047h 96 Tests
EUR 824

Mouse Synaptotagmin- 12, Syt12 ELISA KIT

ELI-52194m 96 Tests
EUR 865

Human Synaptotagmin 12 (SYT12) ELISA Kit

abx383590-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Synaptotagmin XII (SYT12)ELISA Kit

201-12-2575 96 tests
EUR 440
  • This Synaptotagmin XII ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

SYT12 sgRNA CRISPR Lentivector set (Human)

K2323601 3 x 1.0 ug
EUR 339

Syt12 sgRNA CRISPR Lentivector set (Mouse)

K3603401 3 x 1.0 ug
EUR 339

Syt12 sgRNA CRISPR Lentivector set (Rat)

K6942201 3 x 1.0 ug
EUR 339

Human Synaptotagmin XII(SYT12)ELISA Kit

QY-E01180 96T
EUR 361

SYT12 sgRNA CRISPR Lentivector (Human) (Target 1)

K2323602 1.0 ug DNA
EUR 154

SYT12 sgRNA CRISPR Lentivector (Human) (Target 2)

K2323603 1.0 ug DNA
EUR 154

SYT12 sgRNA CRISPR Lentivector (Human) (Target 3)

K2323604 1.0 ug DNA
EUR 154

Syt12 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3603402 1.0 ug DNA
EUR 154

Syt12 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3603403 1.0 ug DNA
EUR 154

Syt12 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3603404 1.0 ug DNA
EUR 154

ELISA kit for Rat Synaptotagmin-12 (SYT12)

KTE100155-48T 48T
EUR 332
  • SYT12 is a member of the synaptotagmin gene family and encodes a protein similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. Studies of the orthologous gene in rat have shown tha
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-12 (SYT12) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Synaptotagmin-12 (SYT12)

KTE100155-5platesof96wells 5 plates of 96 wells
EUR 2115
  • SYT12 is a member of the synaptotagmin gene family and encodes a protein similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. Studies of the orthologous gene in rat have shown tha
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-12 (SYT12) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Synaptotagmin-12 (SYT12)

KTE100155-96T 96T
EUR 539
  • SYT12 is a member of the synaptotagmin gene family and encodes a protein similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. Studies of the orthologous gene in rat have shown tha
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-12 (SYT12) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-12 (SYT12)

KTE70297-48T 48T
EUR 332
  • SYT12 is a member of the synaptotagmin gene family and encodes a protein similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. Studies of the orthologous gene in rat have shown tha
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-12 (SYT12) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-12 (SYT12)

KTE70297-5platesof96wells 5 plates of 96 wells
EUR 2115
  • SYT12 is a member of the synaptotagmin gene family and encodes a protein similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. Studies of the orthologous gene in rat have shown tha
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-12 (SYT12) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-12 (SYT12)

KTE70297-96T 96T
EUR 539
  • SYT12 is a member of the synaptotagmin gene family and encodes a protein similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. Studies of the orthologous gene in rat have shown tha
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-12 (SYT12) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Syt12 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6942202 1.0 ug DNA
EUR 154

Syt12 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6942203 1.0 ug DNA
EUR 154

Syt12 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6942204 1.0 ug DNA
EUR 154

ELISA kit for Human Synaptotagmin-12 (SYT12)

KTE60427-48T 48T
EUR 332
  • Syt12 colocalises with and binds Syt1 on synaptic vesicles, but regulates spontaneous release independently from Syt1. Syt12 is phosphorylated by cAMP-dependent protein kinase A (PKA) at a single site, and mutation of this site blocks the effect of S
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-12 (SYT12) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Synaptotagmin-12 (SYT12)

KTE60427-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Syt12 colocalises with and binds Syt1 on synaptic vesicles, but regulates spontaneous release independently from Syt1. Syt12 is phosphorylated by cAMP-dependent protein kinase A (PKA) at a single site, and mutation of this site blocks the effect of S
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-12 (SYT12) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Synaptotagmin-12 (SYT12)

KTE60427-96T 96T
EUR 539
  • Syt12 colocalises with and binds Syt1 on synaptic vesicles, but regulates spontaneous release independently from Syt1. Syt12 is phosphorylated by cAMP-dependent protein kinase A (PKA) at a single site, and mutation of this site blocks the effect of S
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-12 (SYT12) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

SYT12 Protein Vector (Human) (pPB-C-His)

PV041029 500 ng
EUR 329

SYT12 Protein Vector (Human) (pPB-N-His)

PV041030 500 ng
EUR 329

SYT12 Protein Vector (Human) (pPM-C-HA)

PV041031 500 ng
EUR 329

SYT12 Protein Vector (Human) (pPM-C-His)

PV041032 500 ng
EUR 329

SYT12 Protein Vector (Rat) (pPB-C-His)

PV309298 500 ng
EUR 603

SYT12 Protein Vector (Rat) (pPB-N-His)

PV309299 500 ng
EUR 603

SYT12 Protein Vector (Rat) (pPM-C-HA)

PV309300 500 ng
EUR 603

SYT12 Protein Vector (Rat) (pPM-C-His)

PV309301 500 ng
EUR 603

SYT12 Protein Vector (Mouse) (pPB-C-His)

PV235814 500 ng
EUR 603

SYT12 Protein Vector (Mouse) (pPB-N-His)

PV235815 500 ng
EUR 603

SYT12 Protein Vector (Mouse) (pPM-C-HA)

PV235816 500 ng
EUR 603

SYT12 Protein Vector (Mouse) (pPM-C-His)

PV235817 500 ng
EUR 603

Syt12 3'UTR GFP Stable Cell Line

TU170038 1.0 ml Ask for price

Syt12 3'UTR Luciferase Stable Cell Line

TU120038 1.0 ml Ask for price

SYT12 3'UTR GFP Stable Cell Line

TU075032 1.0 ml
EUR 1521

SYT12 3'UTR Luciferase Stable Cell Line

TU025032 1.0 ml
EUR 1521

Syt12 3'UTR Luciferase Stable Cell Line

TU221484 1.0 ml Ask for price

Syt12 3'UTR GFP Stable Cell Line

TU271484 1.0 ml Ask for price

SYT12 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV658111 1.0 ug DNA
EUR 682

SYT12 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV658115 1.0 ug DNA
EUR 682

SYT12 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV658116 1.0 ug DNA
EUR 682

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

SYT12 Rabbit Polyclonal Antibody