TRPV5 Rabbit Polyclonal Antibody

TRPV5 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

TRPV5 Polyclonal Antibody
ES10390-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against TRPV5 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

TRPV5 Rabbit pAb
A6473-100ul	Abclonal	100 ul	EUR 308

TRPV5 Rabbit pAb
A6473-200ul	Abclonal	200 ul	EUR 459

TRPV5 Rabbit pAb
A6473-20ul	Abclonal	20 ul	EUR 183

TRPV5 Rabbit pAb
A6473-50ul	Abclonal	50 ul	EUR 223

TRPV5 antibody
38948-100ul	SAB	100ul	EUR 252

TRPV5 Antibody
43169-100ul	SAB	100ul	EUR 252

TRPV5 Antibody
1-CSB-PA885690ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against TRPV5. Recognizes TRPV5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

TRPV5 Antibody
1-CSB-PA909076	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TRPV5. Recognizes TRPV5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

TRPV5 Antibody
1-CSB-PA182372	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TRPV5. Recognizes TRPV5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

TRPV5 antibody
70R-5176	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal TRPV5 antibody raised against the N terminal of TRPV5

Polyclonal Goat Anti-TRPV5 Antibody
AMM05147G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-TRPV5 . This antibody is tested and proven to work in the following applications:

Anti-TRPV5 Antibody
A03218-1	BosterBio	100ug/vial	EUR 334

TRPV5 Conjugated Antibody
C38948	SAB	100ul	EUR 397

anti- TRPV5 antibody
FNab09029	FN Test	100µg	EUR 548.75
Recommended dilution: IF: 1:10-1:100 Immunogen: transient receptor potential cation channel, subfamily V, member 5 Uniprot ID: Q9NQA5 Gene ID: 56302 Research Area: Epigenetics, Metabolism
Description: Antibody raised against TRPV5

Anti-TRPV5 antibody
PAab09029	Lifescience Market	100 ug	EUR 386

Anti-TRPV5 antibody
STJ28556	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the transient receptor family and the TrpV subfamily. The calcium-selective channel encoded by this gene has 6 transmembrane-spanning domains, multiple potential phosphorylation sites, an N-linked glycosylation site, and 5 ANK repeats. This protein forms homotetramers or heterotetramers and is activated by a low internal calcium level.

Anti-TRPV5 Antibody
PB9518	BosterBio	100ug/vial	EUR 294

Anti-TRPV5 antibody
STJ71557	St John's Laboratory	100 µg	EUR 359

Anti-TRPV5 antibody
STJ191548	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to TRPV5

Trpv5/ Rat Trpv5 ELISA Kit
ELI-28433r	Lifescience Market	96 Tests	EUR 886

TRPV5 siRNA
20-abx905817	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TRPV5 siRNA
20-abx938248	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TRPV5 siRNA
20-abx938249	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-TRPV5
YF-PA26419	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to TRPV5

Anti-TRPV5, Biotinylated antibody
STJ73235	St John's Laboratory	100 µg	EUR 359

TRPV5 Blocking Peptide
33R-6206	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TRPV5 antibody, catalog no. 70R-5176

TRPV5 cloning plasmid
CSB-CL885690HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1146 Sequence: atggggggttttctacctaaggcagaagggcccgggagccaactccagaaacttctgccctcctttctggtcagagaacaagactgggaccagcacctggacaagcttcatatgctgcagcagaagaggattctagagtctccactgcttcgagcatccaaggaaaatgacctgt Show more
Description: A cloning plasmid for the TRPV5 gene.

Anti-TRPV5 (2A6)
YF-MA18952	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to TRPV5

Anti-TRPV5 (6D6)
YF-MA18953	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to TRPV5

pENTR223-TRPV5 vector
PVT12029	Lifescience Market	2 ug	EUR 308

Mouse Trpv5 ELISA KIT
ELI-16586m	Lifescience Market	96 Tests	EUR 865

Human TRPV5 ELISA KIT
ELI-28935h	Lifescience Market	96 Tests	EUR 824

TRPV5 ELISA KIT|Human
EF003874	Lifescience Market	96 Tests	EUR 689

Rat TRPV5 shRNA Plasmid
20-abx987249	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human TRPV5 shRNA Plasmid
20-abx961133	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse TRPV5 shRNA Plasmid
20-abx980467	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TRPV5 Recombinant Protein (Rat)
RP234902	ABM	100 ug	Ask for price

TRPV5 Recombinant Protein (Human)
RP033085	ABM	100 ug	Ask for price

TRPV5 Recombinant Protein (Mouse)
RP181607	ABM	100 ug	Ask for price

Monoclonal TRPV5 Antibody (monoclonal) (M02), Clone: 2A6
APR10543G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human TRPV5 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 2A6. This antibody is applicable in WB, E

Monoclonal TRPV5 Antibody (monoclonal) (M06), Clone: 6D6
APR10544G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human TRPV5 (monoclonal) (M06). The antibodies are raised in mouse and are from clone 6D6. This antibody is applicable in WB

Trpv5 ORF Vector (Rat) (pORF)
ORF078302	ABM	1.0 ug DNA	EUR 506

TRPV5 ORF Vector (Human) (pORF)
ORF011029	ABM	1.0 ug DNA	EUR 95

Trpv5 ORF Vector (Mouse) (pORF)
ORF060537	ABM	1.0 ug DNA	EUR 506

Trpv5 sgRNA CRISPR Lentivector set (Rat)
K7042901	ABM	3 x 1.0 ug	EUR 339

TRPV5 sgRNA CRISPR Lentivector set (Human)
K2537301	ABM	3 x 1.0 ug	EUR 339

Trpv5 sgRNA CRISPR Lentivector set (Mouse)
K4078601	ABM	3 x 1.0 ug	EUR 339

Trpv5 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7042902	ABM	1.0 ug DNA	EUR 154

Trpv5 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7042903	ABM	1.0 ug DNA	EUR 154

Trpv5 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7042904	ABM	1.0 ug DNA	EUR 154

TRPV5 sgRNA CRISPR Lentivector (Human) (Target 1)
K2537302	ABM	1.0 ug DNA	EUR 154

TRPV5 sgRNA CRISPR Lentivector (Human) (Target 2)
K2537303	ABM	1.0 ug DNA	EUR 154

TRPV5 sgRNA CRISPR Lentivector (Human) (Target 3)
K2537304	ABM	1.0 ug DNA	EUR 154

Trpv5 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4078602	ABM	1.0 ug DNA	EUR 154

Trpv5 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4078603	ABM	1.0 ug DNA	EUR 154

Trpv5 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4078604	ABM	1.0 ug DNA	EUR 154

Trpv5 3'UTR Luciferase Stable Cell Line
TU121200	ABM	1.0 ml	Ask for price

Trpv5 3'UTR GFP Stable Cell Line
TU171200	ABM	1.0 ml	Ask for price

Trpv5 3'UTR Luciferase Stable Cell Line
TU222519	ABM	1.0 ml	Ask for price

TRPV5 3'UTR GFP Stable Cell Line
TU077273	ABM	1.0 ml	EUR 1394

TRPV5 3'UTR Luciferase Stable Cell Line
TU027273	ABM	1.0 ml	EUR 1394

Trpv5 3'UTR GFP Stable Cell Line
TU272519	ABM	1.0 ml	Ask for price

TRPV5 Protein Vector (Rat) (pPB-C-His)
PV313206	ABM	500 ng	EUR 1191

TRPV5 Protein Vector (Rat) (pPB-N-His)
PV313207	ABM	500 ng	EUR 1191

TRPV5 Protein Vector (Rat) (pPM-C-HA)
PV313208	ABM	500 ng	EUR 1191

TRPV5 Protein Vector (Rat) (pPM-C-His)
PV313209	ABM	500 ng	EUR 1191

TRPV5 Protein Vector (Mouse) (pPB-C-His)
PV242146	ABM	500 ng	EUR 1065

TRPV5 Protein Vector (Mouse) (pPB-N-His)
PV242147	ABM	500 ng	EUR 1065

TRPV5 Protein Vector (Mouse) (pPM-C-HA)
PV242148	ABM	500 ng	EUR 1065

TRPV5 Protein Vector (Mouse) (pPM-C-His)
PV242149	ABM	500 ng	EUR 1065

TRPV5 Protein Vector (Human) (pPB-C-His)
PV044113	ABM	500 ng	EUR 329

TRPV5 Protein Vector (Human) (pPB-N-His)
PV044114	ABM	500 ng	EUR 329

TRPV5 Protein Vector (Human) (pPM-C-HA)
PV044115	ABM	500 ng	EUR 329

TRPV5 Protein Vector (Human) (pPM-C-His)
PV044116	ABM	500 ng	EUR 329

TRPV5 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV692929	ABM	1.0 ug DNA	EUR 1355

TRPV5 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV692933	ABM	1.0 ug DNA	EUR 1355

TRPV5 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV692934	ABM	1.0 ug DNA	EUR 1355

Transient Receptor Potential Cation Channel Subfamily V Member 5 (TRPV5) Antibody
20-abx004963	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Transient Receptor Potential Cation Channel Subfamily V Member 5 (TRPV5) Antibody
20-abx210734	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Transient Receptor Potential Cation Channel Subfamily V Member 5 (TRPV5) Antibody
20-abx210735	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Transient Receptor Potential Cation Channel Subfamily V Member 5 (TRPV5) Antibody
20-abx142280	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Transient Receptor Potential Cation Channel Subfamily V Member 5 (TRPV5) Antibody
abx029048-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Transient Receptor Potential Cation Channel Subfamily V Member 5 (TRPV5) Antibody
abx029048-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Transient Receptor Potential Cation Channel Subfamily V Member 5 (TRPV5) Antibody
abx239029-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Transient Receptor Potential Cation Channel Subfamily V Member 5 (TRPV5) Antibody
20-abx321721	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Transient Receptor Potential Cation Channel Subfamily V Member 5 (TRPV5) Antibody
abx431550-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

TRPV5 Rabbit Polyclonal Antibody