October 28, 2021

NOL4 Rabbit Polyclonal Antibody

NOL4 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

NOL4 Antibody

46109-100ul 100ul
EUR 252

NOL4 Antibody

46109-50ul 50ul
EUR 187

NOL4 Antibody

DF9719 200ul
EUR 304
Description: NOL4 Antibody detects endogenous levels of total NOL4.

NOL4 Conjugated Antibody

C46109 100ul
EUR 397

anti- NOL4 antibody

FNab05785 100µg
EUR 505.25
  • Immunogen: nucleolar protein 4
  • Uniprot ID: O94818
  • Gene ID: 8715
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against NOL4

Anti-NOL4 antibody

PAab05785 100 ug
EUR 355

Anti-NOL4 antibody

STJ191114 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NOL4


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


PVT18438 2 ug
EUR 231


YF-PA15817 50 ul
EUR 363
Description: Mouse polyclonal to NOL4


YF-PA25164 50 ul
EUR 334
Description: Mouse polyclonal to NOL4

NOL4 cloning plasmid

CSB-CL015922HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1269
  • Sequence: atgcatgtggaaacggggccaaatggagaacaaattcggaaacacgctggacaaaagagaacttacaaagcaatttcagagagctatgccttcctaccaagagaagcggtgacacgatttctaatgagctgctcagagtgccagaaaagaatgcatttaaacccagatggaacag
  • Show more
Description: A cloning plasmid for the NOL4 gene.

NOL4 Blocking Peptide

33R-8832 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NOL4 antibody, catalog no. 70R-4720

NOL4 Blocking Peptide

DF9719-BP 1mg
EUR 195

pENTR223-NOL4 vector

PVT12100 2 ug
EUR 308

Anti-NOL4 (2A10)

YF-MA11095 100 ug
EUR 363
Description: Mouse monoclonal to NOL4

Nucleolar Protein 4 (NOL4) Antibody

abx029414-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Nucleolar Protein 4 (NOL4) Antibody

abx029414-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Nucleolar Protein 4 (NOL4) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Nucleolar Protein 4 (NOL4) Antibody

abx235785-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Mouse NOL4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF001276 96 Tests
EUR 689

Human NOL4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NOL4 Recombinant Protein (Human)

RP021433 100 ug Ask for price

NOL4 Recombinant Protein (Rat)

RP214199 100 ug Ask for price

NOL4 Recombinant Protein (Mouse)

RP154517 100 ug Ask for price

NOL4 Recombinant Protein (Mouse)

RP154520 100 ug Ask for price

NOL4 ORF Vector (Human) (pORF)

ORF007145 1.0 ug DNA
EUR 95

Nol4 ORF Vector (Rat) (pORF)

ORF071401 1.0 ug DNA
EUR 506

Nol4 ORF Vector (Mouse) (pORF)

ORF051507 1.0 ug DNA
EUR 506

Nol4 ORF Vector (Mouse) (pORF)

ORF051508 1.0 ug DNA
EUR 506

NOL4 sgRNA CRISPR Lentivector set (Human)

K1439001 3 x 1.0 ug
EUR 339

Nol4 sgRNA CRISPR Lentivector set (Mouse)

K3634501 3 x 1.0 ug
EUR 339

Nol4 sgRNA CRISPR Lentivector set (Rat)

K6412201 3 x 1.0 ug
EUR 339

Mouse Nucleolar protein 4, Nol4 ELISA KIT

ELI-22275m 96 Tests
EUR 865

Human Nucleolar protein 4, NOL4 ELISA KIT

ELI-16700h 96 Tests
EUR 824

Human Nucleolar Protein 4 (NOL4) ELISA Kit

abx381840-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

NOL4 sgRNA CRISPR Lentivector (Human) (Target 1)

K1439002 1.0 ug DNA
EUR 154

NOL4 sgRNA CRISPR Lentivector (Human) (Target 2)

K1439003 1.0 ug DNA
EUR 154

NOL4 sgRNA CRISPR Lentivector (Human) (Target 3)

K1439004 1.0 ug DNA
EUR 154

Nol4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3634502 1.0 ug DNA
EUR 154

Nol4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3634503 1.0 ug DNA
EUR 154

Nol4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3634504 1.0 ug DNA
EUR 154

Nol4 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6412202 1.0 ug DNA
EUR 154

Nol4 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6412203 1.0 ug DNA
EUR 154

Nol4 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6412204 1.0 ug DNA
EUR 154

Human Nucleolar Protein 4(NOL4)ELISA Kit  

QY-E03191 96T
EUR 394

NOL4 Protein Vector (Human) (pPB-C-His)

PV028577 500 ng
EUR 329

NOL4 Protein Vector (Human) (pPB-N-His)

PV028578 500 ng
EUR 329

NOL4 Protein Vector (Human) (pPM-C-HA)

PV028579 500 ng
EUR 329

NOL4 Protein Vector (Human) (pPM-C-His)

PV028580 500 ng
EUR 329

NOL4 Protein Vector (Mouse) (pPB-C-His)

PV206026 500 ng
EUR 603

NOL4 Protein Vector (Mouse) (pPB-N-His)

PV206027 500 ng
EUR 603

NOL4 Protein Vector (Mouse) (pPM-C-HA)

PV206028 500 ng
EUR 603

NOL4 Protein Vector (Mouse) (pPM-C-His)

PV206029 500 ng
EUR 603

NOL4 Protein Vector (Mouse) (pPB-C-His)

PV206030 500 ng
EUR 603

NOL4 Protein Vector (Mouse) (pPB-N-His)

PV206031 500 ng
EUR 603

NOL4 Protein Vector (Mouse) (pPM-C-HA)

PV206032 500 ng
EUR 603

NOL4 Protein Vector (Mouse) (pPM-C-His)

PV206033 500 ng
EUR 603

NOL4 Protein Vector (Rat) (pPB-C-His)

PV285602 500 ng
EUR 603

NOL4 Protein Vector (Rat) (pPB-N-His)

PV285603 500 ng
EUR 603

NOL4 Protein Vector (Rat) (pPM-C-HA)

PV285604 500 ng
EUR 603

NOL4 Protein Vector (Rat) (pPM-C-His)

PV285605 500 ng
EUR 603

Nol4 3'UTR GFP Stable Cell Line

TU164198 1.0 ml Ask for price

NOL4 3'UTR Luciferase Stable Cell Line

TU015805 1.0 ml
EUR 1521

Nol4 3'UTR Luciferase Stable Cell Line

TU114198 1.0 ml Ask for price

NOL4 3'UTR GFP Stable Cell Line

TU065805 1.0 ml
EUR 1521

Nol4 3'UTR GFP Stable Cell Line

TU264073 1.0 ml Ask for price

Nol4 3'UTR Luciferase Stable Cell Line

TU214073 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NOL4 Rabbit Polyclonal Antibody