RGL2 Rabbit Polyclonal Antibody

RGL2 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

RGL2 Polyclonal Antibody
ABP60146-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human RGL2 protein at amino acid sequence of 130-210 Applications tips:
Description: A polyclonal antibody for detection of RGL2 from Human, Mouse. This RGL2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RGL2 protein at amino acid sequence of 130-210

RGL2 Polyclonal Antibody
ABP60146-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human RGL2 protein at amino acid sequence of 130-210 Applications tips:
Description: A polyclonal antibody for detection of RGL2 from Human, Mouse. This RGL2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RGL2 protein at amino acid sequence of 130-210

RGL2 Polyclonal Antibody
ABP60146-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human RGL2 protein at amino acid sequence of 130-210 Applications tips:
Description: A polyclonal antibody for detection of RGL2 from Human, Mouse. This RGL2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RGL2 protein at amino acid sequence of 130-210

RGL2 Antibody
1-CSB-PA019625LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RGL2. Recognizes RGL2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

Anti-RGL2 antibody
STJ191247	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to RGL2

RGL2 siRNA
20-abx931365	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RGL2 siRNA
20-abx931366	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RGL2 Antibody, HRP conjugated
1-CSB-PA019625LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RGL2. Recognizes RGL2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RGL2 Antibody, FITC conjugated
1-CSB-PA019625LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RGL2. Recognizes RGL2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RGL2 Antibody, Biotin conjugated
1-CSB-PA019625LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RGL2. Recognizes RGL2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RGL2 cloning plasmid
CSB-CL019625HU-10ug	Cusabio	10ug	EUR 763
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2334 Sequence: atgctcccgcggcccctgcggctgcttttggacacgagcccccccgggggagtcgtactgagcagcttccgaagccgggaccccgaagagggtgggggcccaggtggcctggtcgtgggcggggggcaggaggaagaggaggaggaagaagaagaggcccctgtgtccgtctggg Show more
Description: A cloning plasmid for the RGL2 gene.

Anti-RGL2 (4F1)
YF-MA15078	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to RGL2

Anti-RGL2 (4D10)
YF-MA15079	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to RGL2

Canine RGL2 ELISA KIT
ELI-18039d	Lifescience Market	96 Tests	EUR 928

Mouse Rgl2 ELISA KIT
ELI-18092m	Lifescience Market	96 Tests	EUR 865

Human RGL2 ELISA KIT
ELI-21940h	Lifescience Market	96 Tests	EUR 824

Human RGL2 shRNA Plasmid
20-abx953953	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse RGL2 shRNA Plasmid
20-abx972449	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RGL2 Recombinant Protein (Human)
RP026275	ABM	100 ug	Ask for price

RGL2 Recombinant Protein (Rat)
RP225905	ABM	100 ug	Ask for price

RGL2 Recombinant Protein (Mouse)
RP167834	ABM	100 ug	Ask for price

Monoclonal RGL2 Antibody (monoclonal) (M02), Clone: 4D10
AMM07571G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human RGL2 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 4D10. This antibody is applicable in WB and IF, E

RGL2 ORF Vector (Human) (pORF)
ORF008759	ABM	1.0 ug DNA	EUR 95

Rgl2 ORF Vector (Mouse) (pORF)
ORF055946	ABM	1.0 ug DNA	EUR 506

Rgl2 ORF Vector (Rat) (pORF)
ORF075303	ABM	1.0 ug DNA	EUR 506

RGL2 sgRNA CRISPR Lentivector set (Human)
K1815001	ABM	3 x 1.0 ug	EUR 339

Rgl2 sgRNA CRISPR Lentivector set (Rat)
K7234501	ABM	3 x 1.0 ug	EUR 339

Rgl2 sgRNA CRISPR Lentivector set (Mouse)
K4834401	ABM	3 x 1.0 ug	EUR 339

Ral Guanine Nucleotide Dissociation Stimulator Like 2 (RGL2) Antibody
20-abx338795	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

RGL2 sgRNA CRISPR Lentivector (Human) (Target 1)
K1815002	ABM	1.0 ug DNA	EUR 154

RGL2 sgRNA CRISPR Lentivector (Human) (Target 2)
K1815003	ABM	1.0 ug DNA	EUR 154

RGL2 sgRNA CRISPR Lentivector (Human) (Target 3)
K1815004	ABM	1.0 ug DNA	EUR 154

Rgl2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7234502	ABM	1.0 ug DNA	EUR 154

Rgl2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7234503	ABM	1.0 ug DNA	EUR 154

Rgl2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7234504	ABM	1.0 ug DNA	EUR 154

Rgl2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4834402	ABM	1.0 ug DNA	EUR 154

Rgl2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4834403	ABM	1.0 ug DNA	EUR 154

Rgl2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4834404	ABM	1.0 ug DNA	EUR 154

RGL2 Protein Vector (Human) (pPB-C-His)
PV035033	ABM	500 ng	EUR 329

RGL2 Protein Vector (Human) (pPB-N-His)
PV035034	ABM	500 ng	EUR 329

RGL2 Protein Vector (Human) (pPM-C-HA)
PV035035	ABM	500 ng	EUR 329

RGL2 Protein Vector (Human) (pPM-C-His)
PV035036	ABM	500 ng	EUR 329

RGL2 Protein Vector (Rat) (pPB-C-His)
PV301210	ABM	500 ng	EUR 1166

RGL2 Protein Vector (Rat) (pPB-N-His)
PV301211	ABM	500 ng	EUR 1166

RGL2 Protein Vector (Rat) (pPM-C-HA)
PV301212	ABM	500 ng	EUR 1166

RGL2 Protein Vector (Rat) (pPM-C-His)
PV301213	ABM	500 ng	EUR 1166

RGL2 Protein Vector (Mouse) (pPB-C-His)
PV223782	ABM	500 ng	EUR 1065

RGL2 Rabbit Polyclonal Antibody