October 23, 2021

RGL2 Rabbit Polyclonal Antibody

RGL2 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

RGL2 Polyclonal Antibody

ABP60146-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human RGL2 protein at amino acid sequence of 130-210
  • Applications tips:
Description: A polyclonal antibody for detection of RGL2 from Human, Mouse. This RGL2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RGL2 protein at amino acid sequence of 130-210

RGL2 Polyclonal Antibody

ABP60146-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RGL2 protein at amino acid sequence of 130-210
  • Applications tips:
Description: A polyclonal antibody for detection of RGL2 from Human, Mouse. This RGL2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RGL2 protein at amino acid sequence of 130-210

RGL2 Polyclonal Antibody

ABP60146-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RGL2 protein at amino acid sequence of 130-210
  • Applications tips:
Description: A polyclonal antibody for detection of RGL2 from Human, Mouse. This RGL2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RGL2 protein at amino acid sequence of 130-210

RGL2 Antibody

1-CSB-PA019625LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RGL2. Recognizes RGL2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

Anti-RGL2 antibody

STJ191247 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RGL2

RGL2 siRNA

20-abx931365
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RGL2 siRNA

20-abx931366
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RGL2 Antibody, HRP conjugated

1-CSB-PA019625LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RGL2. Recognizes RGL2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RGL2 Antibody, FITC conjugated

1-CSB-PA019625LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RGL2. Recognizes RGL2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RGL2 Antibody, Biotin conjugated

1-CSB-PA019625LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RGL2. Recognizes RGL2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RGL2 cloning plasmid

CSB-CL019625HU-10ug 10ug
EUR 763
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2334
  • Sequence: atgctcccgcggcccctgcggctgcttttggacacgagcccccccgggggagtcgtactgagcagcttccgaagccgggaccccgaagagggtgggggcccaggtggcctggtcgtgggcggggggcaggaggaagaggaggaggaagaagaagaggcccctgtgtccgtctggg
  • Show more
Description: A cloning plasmid for the RGL2 gene.

Anti-RGL2 (4F1)

YF-MA15078 100 ug
EUR 363
Description: Mouse monoclonal to RGL2

Anti-RGL2 (4D10)

YF-MA15079 100 ug
EUR 363
Description: Mouse monoclonal to RGL2

Canine RGL2 ELISA KIT

ELI-18039d 96 Tests
EUR 928

Mouse Rgl2 ELISA KIT

ELI-18092m 96 Tests
EUR 865

Human RGL2 ELISA KIT

ELI-21940h 96 Tests
EUR 824

Human RGL2 shRNA Plasmid

20-abx953953
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse RGL2 shRNA Plasmid

20-abx972449
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RGL2 Recombinant Protein (Human)

RP026275 100 ug Ask for price

RGL2 Recombinant Protein (Rat)

RP225905 100 ug Ask for price

RGL2 Recombinant Protein (Mouse)

RP167834 100 ug Ask for price

Monoclonal RGL2 Antibody (monoclonal) (M02), Clone: 4D10

AMM07571G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human RGL2 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 4D10. This antibody is applicable in WB and IF, E

RGL2 ORF Vector (Human) (pORF)

ORF008759 1.0 ug DNA
EUR 95

Rgl2 ORF Vector (Mouse) (pORF)

ORF055946 1.0 ug DNA
EUR 506

Rgl2 ORF Vector (Rat) (pORF)

ORF075303 1.0 ug DNA
EUR 506

RGL2 sgRNA CRISPR Lentivector set (Human)

K1815001 3 x 1.0 ug
EUR 339

Rgl2 sgRNA CRISPR Lentivector set (Rat)

K7234501 3 x 1.0 ug
EUR 339

Rgl2 sgRNA CRISPR Lentivector set (Mouse)

K4834401 3 x 1.0 ug
EUR 339

Ral Guanine Nucleotide Dissociation Stimulator Like 2 (RGL2) Antibody

20-abx338795
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RGL2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1815002 1.0 ug DNA
EUR 154

RGL2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1815003 1.0 ug DNA
EUR 154

RGL2 sgRNA CRISPR Lentivector (Human) (Target 3)

K1815004 1.0 ug DNA
EUR 154

Rgl2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7234502 1.0 ug DNA
EUR 154

Rgl2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7234503 1.0 ug DNA
EUR 154

Rgl2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7234504 1.0 ug DNA
EUR 154

Rgl2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4834402 1.0 ug DNA
EUR 154

Rgl2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4834403 1.0 ug DNA
EUR 154

Rgl2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4834404 1.0 ug DNA
EUR 154

RGL2 Protein Vector (Human) (pPB-C-His)

PV035033 500 ng
EUR 329

RGL2 Protein Vector (Human) (pPB-N-His)

PV035034 500 ng
EUR 329

RGL2 Protein Vector (Human) (pPM-C-HA)

PV035035 500 ng
EUR 329

RGL2 Protein Vector (Human) (pPM-C-His)

PV035036 500 ng
EUR 329

RGL2 Protein Vector (Rat) (pPB-C-His)

PV301210 500 ng
EUR 1166

RGL2 Protein Vector (Rat) (pPB-N-His)

PV301211 500 ng
EUR 1166

RGL2 Protein Vector (Rat) (pPM-C-HA)

PV301212 500 ng
EUR 1166

RGL2 Protein Vector (Rat) (pPM-C-His)

PV301213 500 ng
EUR 1166

RGL2 Protein Vector (Mouse) (pPB-C-His)

PV223782 500 ng
EUR 1065

RGL2 Rabbit Polyclonal Antibody