PHC3 Rabbit Polyclonal Antibody
To Order Contact us: [email protected]
 PHC3 Polyclonal Antibody |
|
ABP59896-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PHC3 protein at amino acid sequence of 720-800
- Applications tips:
|
|
Description: A polyclonal antibody for detection of PHC3 from Human, Mouse. This PHC3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PHC3 protein at amino acid sequence of 720-800 |
 PHC3 Rabbit pAb |
|
A14151-100ul |
Abclonal |
100 ul |
EUR 308 |
PHC3 Rabbit pAb |
|
A14151-200ul |
Abclonal |
200 ul |
EUR 459 |
PHC3 Rabbit pAb |
|
A14151-20ul |
Abclonal |
20 ul |
EUR 183 |
PHC3 Rabbit pAb |
|
A14151-50ul |
Abclonal |
50 ul |
EUR 223 |
PHC3 Rabbit pAb |
|
A6479-100ul |
Abclonal |
100 ul |
EUR 308 |
PHC3 Rabbit pAb |
|
A6479-200ul |
Abclonal |
200 ul |
EUR 459 |
PHC3 Rabbit pAb |
|
A6479-20ul |
Abclonal |
20 ul |
EUR 183 |
PHC3 Rabbit pAb |
|
A6479-50ul |
Abclonal |
50 ul |
EUR 223 |
 PHC3 antibody |
|
38952-100ul |
SAB |
100ul |
EUR 252 |
 PHC3 Conjugated Antibody |
|
C38952 |
SAB |
100ul |
EUR 397 |
 Anti-PHC3 antibody |
|
STJ191177 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to PHC3 |
 PHC3 siRNA |
|
20-abx928420 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PHC3 siRNA |
|
20-abx928421 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 PHC3 cloning plasmid |
|
CSB-CL847692HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 456
- Sequence: atggcggaagcggaatttaaggaccatagtacagctatggatactgaaccaaacccgggaacatcttctgtgtcaacaacaaccagcagtaccaccaccaccaccatcaccacttcctcctctcgaatgcagcagccacagatctctgtctacagtggttcagaccgacatgctgt
- Show more
|
|
Description: A cloning plasmid for the PHC3 gene. |
PHC3 cloning plasmid |
|
CSB-CL847692HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 408
- Sequence: atggatactgaaccaaacccgggaacatcttctgtgtcaacaacaaccagcagtaccaccaccaccaccatcaccacttcctcctctcgaatgcagcagccacagatctctgtctacagtggttcagaccgacatgctgtacaggcattgcatcggccccccagctcagctgctca
- Show more
|
|
Description: A cloning plasmid for the PHC3 gene. |
PHC3 cloning plasmid |
|
CSB-CL847692HU3-10ug |
Cusabio |
10ug |
EUR 936 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2952
- Sequence: ATGGATACTGAACCAAACCCGGGAACATCTTCTGTGTCAACAACAACCAGCAGTACCACCACCACCACCATCACCACTTCCTCCTCTCGAATGCAGCAGCCACAGATCTCTGTCTACAGTGGTTCAGACCGACATGCTGTACAGGTAATTCAACAGGCATTGCATCGGCCCCCCA
- Show more
|
|
Description: A cloning plasmid for the PHC3 gene. |
 anti-Anti-PHC3 |
|
YF-PA20991 |
Abfrontier |
50 ul |
EUR 363 |
|
Description: Mouse polyclonal to Anti-PHC3 |
 Human PHC3 shRNA Plasmid |
|
20-abx962723 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse PHC3 shRNA Plasmid |
|
20-abx982544 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Antibody) Polyhomeotic-Like Protein 3 (PHC3) Antibody |
|
20-abx142143 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Polyhomeotic-Like Protein 3 (PHC3) Antibody |
|
20-abx004967 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
 (pORF)) PHC3 ORF Vector (Human) (pORF) |
|
ORF007764 |
ABM |
1.0 ug DNA |
EUR 95 |
PHC3 ORF Vector (Human) (pORF) |
|
ORF007765 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Phc3 ORF Vector (Rat) (pORF) |
|
ORF073430 |
ABM |
1.0 ug DNA |
EUR 506 |
PHC3 ORF Vector (Human) (pORF) |
|
ORF014060 |
ABM |
1.0 ug DNA |
EUR 354 |
 (pORF)) Phc3 ORF Vector (Mouse) (pORF) |
|
ORF053905 |
ABM |
1.0 ug DNA |
EUR 506 |
Phc3 ORF Vector (Mouse) (pORF) |
|
ORF053906 |
ABM |
1.0 ug DNA |
EUR 506 |
Phc3 ORF Vector (Mouse) (pORF) |
|
ORF053907 |
ABM |
1.0 ug DNA |
EUR 506 |
Phc3 ORF Vector (Mouse) (pORF) |
|
ORF053908 |
ABM |
1.0 ug DNA |
EUR 506 |
) PHC3 sgRNA CRISPR Lentivector set (Human) |
|
K1638401 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Phc3 sgRNA CRISPR Lentivector set (Mouse) |
|
K4668601 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Phc3 sgRNA CRISPR Lentivector set (Rat) |
|
K6539501 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) PHC3 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K1638402 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) PHC3 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K1638403 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) PHC3 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K1638404 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Phc3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4668602 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Phc3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4668603 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Phc3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4668604 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Phc3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6539502 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Phc3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6539503 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Phc3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6539504 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) PHC3 Protein Vector (Human) (pPB-C-His) |
|
PV056237 |
ABM |
500 ng |
EUR 481 |
 (pPB-N-His)) PHC3 Protein Vector (Human) (pPB-N-His) |
|
PV056238 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-HA)) PHC3 Protein Vector (Human) (pPM-C-HA) |
|
PV056239 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-His)) PHC3 Protein Vector (Human) (pPM-C-His) |
|
PV056240 |
ABM |
500 ng |
EUR 481 |
PHC3 Protein Vector (Human) (pPB-C-His) |
|
PV031053 |
ABM |
500 ng |
EUR 329 |
PHC3 Protein Vector (Human) (pPB-N-His) |
|
PV031054 |
ABM |
500 ng |
EUR 329 |
PHC3 Protein Vector (Human) (pPM-C-HA) |
|
PV031055 |
ABM |
500 ng |
EUR 329 |
PHC3 Protein Vector (Human) (pPM-C-His) |
|
PV031056 |
ABM |
500 ng |
EUR 329 |
PHC3 Protein Vector (Human) (pPB-C-His) |
|
PV031057 |
ABM |
500 ng |
EUR 329 |
PHC3 Protein Vector (Human) (pPB-N-His) |
|
PV031058 |
ABM |
500 ng |
EUR 329 |
PHC3 Protein Vector (Human) (pPM-C-HA) |
|
PV031059 |
ABM |
500 ng |
EUR 329 |
PHC3 Protein Vector (Human) (pPM-C-His) |
|
PV031060 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) PHC3 Protein Vector (Mouse) (pPB-C-His) |
|
PV215618 |
ABM |
500 ng |
EUR 1065 |
 (pPB-N-His)) PHC3 Protein Vector (Mouse) (pPB-N-His) |
|
PV215619 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-HA)) PHC3 Protein Vector (Mouse) (pPM-C-HA) |
|
PV215620 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-His)) PHC3 Protein Vector (Mouse) (pPM-C-His) |
|
PV215621 |
ABM |
500 ng |
EUR 1065 |
PHC3 Protein Vector (Mouse) (pPB-C-His) |
|
PV215622 |
ABM |
500 ng |
EUR 1065 |
PHC3 Protein Vector (Mouse) (pPB-N-His) |
|
PV215623 |
ABM |
500 ng |
EUR 1065 |
PHC3 Protein Vector (Mouse) (pPM-C-HA) |
|
PV215624 |
ABM |
500 ng |
EUR 1065 |
PHC3 Protein Vector (Mouse) (pPM-C-His) |
|
PV215625 |
ABM |
500 ng |
EUR 1065 |
PHC3 Protein Vector (Mouse) (pPB-C-His) |
|
PV215626 |
ABM |
500 ng |
EUR 1065 |
PHC3 Protein Vector (Mouse) (pPB-N-His) |
|
PV215627 |
ABM |
500 ng |
EUR 1065 |
PHC3 Protein Vector (Mouse) (pPM-C-HA) |
|
PV215628 |
ABM |
500 ng |
EUR 1065 |
PHC3 Protein Vector (Mouse) (pPM-C-His) |
|
PV215629 |
ABM |
500 ng |
EUR 1065 |
PHC3 Protein Vector (Mouse) (pPB-C-His) |
|
PV215630 |
ABM |
500 ng |
EUR 1065 |
PHC3 Protein Vector (Mouse) (pPB-N-His) |
|
PV215631 |
ABM |
500 ng |
EUR 1065 |
PHC3 Protein Vector (Mouse) (pPM-C-HA) |
|
PV215632 |
ABM |
500 ng |
EUR 1065 |
PHC3 Protein Vector (Mouse) (pPM-C-His) |
|
PV215633 |
ABM |
500 ng |
EUR 1065 |
 (pPB-C-His)) PHC3 Protein Vector (Rat) (pPB-C-His) |
|
PV293718 |
ABM |
500 ng |
EUR 1166 |
 (pPB-N-His)) PHC3 Protein Vector (Rat) (pPB-N-His) |
|
PV293719 |
ABM |
500 ng |
EUR 1166 |
 (pPM-C-HA)) PHC3 Protein Vector (Rat) (pPM-C-HA) |
|
PV293720 |
ABM |
500 ng |
EUR 1166 |
 (pPM-C-His)) PHC3 Protein Vector (Rat) (pPM-C-His) |
|
PV293721 |
ABM |
500 ng |
EUR 1166 |
 Phc3 3'UTR GFP Stable Cell Line |
|
TU166279 |
ABM |
1.0 ml |
Ask for price |
 PHC3 3'UTR Luciferase Stable Cell Line |
|
TU017841 |
ABM |
1.0 ml |
EUR 1521 |
 Phc3 3'UTR Luciferase Stable Cell Line |
|
TU116279 |
ABM |
1.0 ml |
Ask for price |
 PHC3 3'UTR GFP Stable Cell Line |
|
TU067841 |
ABM |
1.0 ml |
EUR 1521 |
Phc3 3'UTR GFP Stable Cell Line |
|
TU266160 |
ABM |
1.0 ml |
Ask for price |
Phc3 3'UTR Luciferase Stable Cell Line |
|
TU216160 |
ABM |
1.0 ml |
Ask for price |
 Mouse Polyhomeotic- like protein 3, Phc3 ELISA KIT |
|
ELI-16013m |
Lifescience Market |
96 Tests |
EUR 865 |
 Human Polyhomeotic- like protein 3, PHC3 ELISA KIT |
|
ELI-43644h |
Lifescience Market |
96 Tests |
EUR 824 |
 (CMV) (pLenti-GIII-CMV)) PHC3 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
|
LV704517 |
ABM |
1.0 ug DNA |
EUR 450 |
 (UbC) (pLenti-GIII-UbC)) PHC3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
|
LV704521 |
ABM |
1.0 ug DNA |
EUR 450 |
 (EF1a) (pLenti-GIII-EF1a)) PHC3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
|
LV704522 |
ABM |
1.0 ug DNA |
EUR 450 |
PHC3 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
|
LV713385 |
ABM |
1.0 ug DNA |
EUR 316 |
PHC3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
|
LV713389 |
ABM |
1.0 ug DNA |
EUR 316 |
PHC3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
|
LV713390 |
ABM |
1.0 ug DNA |
EUR 316 |
PHC3 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
|
LV713391 |
ABM |
1.0 ug DNA |
EUR 316 |
PHC3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
|
LV713395 |
ABM |
1.0 ug DNA |
EUR 316 |
PHC3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
|
LV713396 |
ABM |
1.0 ug DNA |
EUR 316 |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4a Rabbit Polyclonal Antibody |
|
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
|
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4b Rabbit Polyclonal Antibody |
|
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
|
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4c Rabbit Polyclonal Antibody |
|
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
|
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG5 Rabbit Polyclonal Antibody |
|
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
|
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG7 Rabbit Polyclonal Antibody |
|
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
|
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG13 Rabbit Polyclonal Antibody |
|
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG14L Rabbit Polyclonal Antibody |
|
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
|
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NBR1 Rabbit Polyclonal Antibody |
|
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 WIPI2 Rabbit Polyclonal Antibody |
|
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
|
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Gab1 Rabbit Polyclonal Antibody |
|
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
|
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
PHC3 Rabbit Polyclonal Antibody
