October 26, 2021

PHC3 Rabbit Polyclonal Antibody

PHC3 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

PHC3 Polyclonal Antibody

ABP59896-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PHC3 protein at amino acid sequence of 720-800
  • Applications tips:
Description: A polyclonal antibody for detection of PHC3 from Human, Mouse. This PHC3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PHC3 protein at amino acid sequence of 720-800

PHC3 Rabbit pAb

A14151-100ul 100 ul
EUR 308

PHC3 Rabbit pAb

A14151-200ul 200 ul
EUR 459

PHC3 Rabbit pAb

A14151-20ul 20 ul
EUR 183

PHC3 Rabbit pAb

A14151-50ul 50 ul
EUR 223

PHC3 Rabbit pAb

A6479-100ul 100 ul
EUR 308

PHC3 Rabbit pAb

A6479-200ul 200 ul
EUR 459

PHC3 Rabbit pAb

A6479-20ul 20 ul
EUR 183

PHC3 Rabbit pAb

A6479-50ul 50 ul
EUR 223

PHC3 antibody

38952-100ul 100ul
EUR 252

PHC3 Conjugated Antibody

C38952 100ul
EUR 397

Anti-PHC3 antibody

STJ28562 100 µl
EUR 277

Anti-PHC3 antibody

STJ191177 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PHC3

Anti-PHC3 antibody

STJ116086 100 µl
EUR 277

PHC3 siRNA

20-abx928420
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PHC3 siRNA

20-abx928421
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PHC3 cloning plasmid

CSB-CL847692HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 456
  • Sequence: atggcggaagcggaatttaaggaccatagtacagctatggatactgaaccaaacccgggaacatcttctgtgtcaacaacaaccagcagtaccaccaccaccaccatcaccacttcctcctctcgaatgcagcagccacagatctctgtctacagtggttcagaccgacatgctgt
  • Show more
Description: A cloning plasmid for the PHC3 gene.

PHC3 cloning plasmid

CSB-CL847692HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 408
  • Sequence: atggatactgaaccaaacccgggaacatcttctgtgtcaacaacaaccagcagtaccaccaccaccaccatcaccacttcctcctctcgaatgcagcagccacagatctctgtctacagtggttcagaccgacatgctgtacaggcattgcatcggccccccagctcagctgctca
  • Show more
Description: A cloning plasmid for the PHC3 gene.

PHC3 cloning plasmid

CSB-CL847692HU3-10ug 10ug
EUR 936
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2952
  • Sequence: ATGGATACTGAACCAAACCCGGGAACATCTTCTGTGTCAACAACAACCAGCAGTACCACCACCACCACCATCACCACTTCCTCCTCTCGAATGCAGCAGCCACAGATCTCTGTCTACAGTGGTTCAGACCGACATGCTGTACAGGTAATTCAACAGGCATTGCATCGGCCCCCCA
  • Show more
Description: A cloning plasmid for the PHC3 gene.

anti-Anti-PHC3

YF-PA20991 50 ul
EUR 363
Description: Mouse polyclonal to Anti-PHC3

Human PHC3 shRNA Plasmid

20-abx962723
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PHC3 shRNA Plasmid

20-abx982544
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Polyhomeotic-Like Protein 3 (PHC3) Antibody

20-abx142143
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Polyhomeotic-Like Protein 3 (PHC3) Antibody

20-abx004967
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

PHC3 ORF Vector (Human) (pORF)

ORF007764 1.0 ug DNA
EUR 95

PHC3 ORF Vector (Human) (pORF)

ORF007765 1.0 ug DNA
EUR 95

Phc3 ORF Vector (Rat) (pORF)

ORF073430 1.0 ug DNA
EUR 506

PHC3 ORF Vector (Human) (pORF)

ORF014060 1.0 ug DNA
EUR 354

Phc3 ORF Vector (Mouse) (pORF)

ORF053905 1.0 ug DNA
EUR 506

Phc3 ORF Vector (Mouse) (pORF)

ORF053906 1.0 ug DNA
EUR 506

Phc3 ORF Vector (Mouse) (pORF)

ORF053907 1.0 ug DNA
EUR 506

Phc3 ORF Vector (Mouse) (pORF)

ORF053908 1.0 ug DNA
EUR 506

PHC3 sgRNA CRISPR Lentivector set (Human)

K1638401 3 x 1.0 ug
EUR 339

Phc3 sgRNA CRISPR Lentivector set (Mouse)

K4668601 3 x 1.0 ug
EUR 339

Phc3 sgRNA CRISPR Lentivector set (Rat)

K6539501 3 x 1.0 ug
EUR 339

PHC3 sgRNA CRISPR Lentivector (Human) (Target 1)

K1638402 1.0 ug DNA
EUR 154

PHC3 sgRNA CRISPR Lentivector (Human) (Target 2)

K1638403 1.0 ug DNA
EUR 154

PHC3 sgRNA CRISPR Lentivector (Human) (Target 3)

K1638404 1.0 ug DNA
EUR 154

Phc3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4668602 1.0 ug DNA
EUR 154

Phc3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4668603 1.0 ug DNA
EUR 154

Phc3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4668604 1.0 ug DNA
EUR 154

Phc3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6539502 1.0 ug DNA
EUR 154

Phc3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6539503 1.0 ug DNA
EUR 154

Phc3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6539504 1.0 ug DNA
EUR 154

PHC3 Protein Vector (Human) (pPB-C-His)

PV056237 500 ng
EUR 481

PHC3 Protein Vector (Human) (pPB-N-His)

PV056238 500 ng
EUR 481

PHC3 Protein Vector (Human) (pPM-C-HA)

PV056239 500 ng
EUR 481

PHC3 Protein Vector (Human) (pPM-C-His)

PV056240 500 ng
EUR 481

PHC3 Protein Vector (Human) (pPB-C-His)

PV031053 500 ng
EUR 329

PHC3 Protein Vector (Human) (pPB-N-His)

PV031054 500 ng
EUR 329

PHC3 Protein Vector (Human) (pPM-C-HA)

PV031055 500 ng
EUR 329

PHC3 Protein Vector (Human) (pPM-C-His)

PV031056 500 ng
EUR 329

PHC3 Protein Vector (Human) (pPB-C-His)

PV031057 500 ng
EUR 329

PHC3 Protein Vector (Human) (pPB-N-His)

PV031058 500 ng
EUR 329

PHC3 Protein Vector (Human) (pPM-C-HA)

PV031059 500 ng
EUR 329

PHC3 Protein Vector (Human) (pPM-C-His)

PV031060 500 ng
EUR 329

PHC3 Protein Vector (Mouse) (pPB-C-His)

PV215618 500 ng
EUR 1065

PHC3 Protein Vector (Mouse) (pPB-N-His)

PV215619 500 ng
EUR 1065

PHC3 Protein Vector (Mouse) (pPM-C-HA)

PV215620 500 ng
EUR 1065

PHC3 Protein Vector (Mouse) (pPM-C-His)

PV215621 500 ng
EUR 1065

PHC3 Protein Vector (Mouse) (pPB-C-His)

PV215622 500 ng
EUR 1065

PHC3 Protein Vector (Mouse) (pPB-N-His)

PV215623 500 ng
EUR 1065

PHC3 Protein Vector (Mouse) (pPM-C-HA)

PV215624 500 ng
EUR 1065

PHC3 Protein Vector (Mouse) (pPM-C-His)

PV215625 500 ng
EUR 1065

PHC3 Protein Vector (Mouse) (pPB-C-His)

PV215626 500 ng
EUR 1065

PHC3 Protein Vector (Mouse) (pPB-N-His)

PV215627 500 ng
EUR 1065

PHC3 Protein Vector (Mouse) (pPM-C-HA)

PV215628 500 ng
EUR 1065

PHC3 Protein Vector (Mouse) (pPM-C-His)

PV215629 500 ng
EUR 1065

PHC3 Protein Vector (Mouse) (pPB-C-His)

PV215630 500 ng
EUR 1065

PHC3 Protein Vector (Mouse) (pPB-N-His)

PV215631 500 ng
EUR 1065

PHC3 Protein Vector (Mouse) (pPM-C-HA)

PV215632 500 ng
EUR 1065

PHC3 Protein Vector (Mouse) (pPM-C-His)

PV215633 500 ng
EUR 1065

PHC3 Protein Vector (Rat) (pPB-C-His)

PV293718 500 ng
EUR 1166

PHC3 Protein Vector (Rat) (pPB-N-His)

PV293719 500 ng
EUR 1166

PHC3 Protein Vector (Rat) (pPM-C-HA)

PV293720 500 ng
EUR 1166

PHC3 Protein Vector (Rat) (pPM-C-His)

PV293721 500 ng
EUR 1166

Phc3 3'UTR GFP Stable Cell Line

TU166279 1.0 ml Ask for price

PHC3 3'UTR Luciferase Stable Cell Line

TU017841 1.0 ml
EUR 1521

Phc3 3'UTR Luciferase Stable Cell Line

TU116279 1.0 ml Ask for price

PHC3 3'UTR GFP Stable Cell Line

TU067841 1.0 ml
EUR 1521

Phc3 3'UTR GFP Stable Cell Line

TU266160 1.0 ml Ask for price

Phc3 3'UTR Luciferase Stable Cell Line

TU216160 1.0 ml Ask for price

Mouse Polyhomeotic- like protein 3, Phc3 ELISA KIT

ELI-16013m 96 Tests
EUR 865

Human Polyhomeotic- like protein 3, PHC3 ELISA KIT

ELI-43644h 96 Tests
EUR 824

PHC3 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV704517 1.0 ug DNA
EUR 450

PHC3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV704521 1.0 ug DNA
EUR 450

PHC3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV704522 1.0 ug DNA
EUR 450

PHC3 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV713385 1.0 ug DNA
EUR 316

PHC3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV713389 1.0 ug DNA
EUR 316

PHC3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV713390 1.0 ug DNA
EUR 316

PHC3 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV713391 1.0 ug DNA
EUR 316

PHC3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV713395 1.0 ug DNA
EUR 316

PHC3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV713396 1.0 ug DNA
EUR 316

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

PHC3 Rabbit Polyclonal Antibody