January 17, 2022

SRP54 Rabbit Polyclonal Antibody

SRP54 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

SRP54 Polyclonal Antibody

ES10260-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against SRP54 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

SRP54 Polyclonal Antibody

ES10260-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SRP54 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

SRP54 Rabbit pAb

A4126-100ul 100 ul
EUR 308

SRP54 Rabbit pAb

A4126-200ul 200 ul
EUR 459

SRP54 Rabbit pAb

A4126-20ul 20 ul
EUR 183

SRP54 Rabbit pAb

A4126-50ul 50 ul
EUR 223

SRP54 antibody

70R-20523 50 ul
EUR 435
Description: Rabbit polyclonal SRP54 antibody

SRP54 Antibody

40106-100ul 100ul
EUR 252

SRP54 Antibody

1-CSB-PA080227
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SRP54. Recognizes SRP54 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

SRP54 Antibody

DF12479 200ul
EUR 304
Description: SRP54 antibody detects endogenous levels of SRP54.

SRP54 Antibody

1-CSB-PA228089
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SRP54. Recognizes SRP54 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150

SRP54 antibody

70R-4849 50 ug
EUR 467
Description: Rabbit polyclonal SRP54 antibody raised against the middle region of SRP54

SRP54 Antibody

1-CSB-PA022675GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SRP54. Recognizes SRP54 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

SRP54 Antibody

1-CSB-PA022675LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SRP54. Recognizes SRP54 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200

SRP54 Polyclonal Antibody, HRP Conjugated

A63499 100 µg
EUR 570.55
Description: The best epigenetics products

SRP54 Polyclonal Antibody, FITC Conjugated

A63500 100 µg
EUR 570.55
Description: kits suitable for this type of research

SRP54 Polyclonal Antibody, Biotin Conjugated

A63501 100 µg
EUR 570.55
Description: fast delivery possible

Srp54/ Rat Srp54 ELISA Kit

ELI-29869r 96 Tests
EUR 886

SRP54 Conjugated Antibody

C40106 100ul
EUR 397

anti- SRP54 antibody

FNab08232 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • IP: 1:500-1:1000
  • IHC:1:20-1:200
  • Immunogen: signal recognition particle 54kDa
  • Uniprot ID: P61011
  • Gene ID: 6729
  • Research Area: Epigenetics, Signal Transduction, Metabolism
Description: Antibody raised against SRP54

anti- SRP54 antibody

FNab08233 100µg
EUR 548.75
  • Immunogen: signal recognition particle 54kDa
  • Uniprot ID: P61011
  • Gene ID: 6729
  • Research Area: Epigenetics, Signal Transduction, Metabolism
Description: Antibody raised against SRP54

Anti-SRP54 antibody

PAab08232 100 ug
EUR 386

Anti-SRP54 antibody

PAab08233 100 ug
EUR 386

Anti-SRP54 antibody

STJ25695 100 µl
EUR 277

Anti-SRP54 antibody

STJ191418 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SRP54

SRP54 siRNA

20-abx935170
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SRP54 siRNA

20-abx935171
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SRP54 Antibody, HRP conjugated

1-CSB-PA022675LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SRP54. Recognizes SRP54 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SRP54 Antibody, FITC conjugated

1-CSB-PA022675LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SRP54. Recognizes SRP54 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SRP54 Antibody, Biotin conjugated

1-CSB-PA022675LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SRP54. Recognizes SRP54 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SRP54 Blocking Peptide

33R-2603 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SRP54 antibody, catalog no. 70R-4849

SRP54 Blocking Peptide

DF12479-BP 1mg
EUR 195

SRP54 cloning plasmid

CSB-CL022675HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1515
  • Sequence: atggttctagcagaccttggaagaaaaataacatcagcattacgctcgttgagcaatgccaccattatcaatgaagaggtattgaatgctatgctaaaagaagtctgtaccgctttgttggaagcagatgttaatattaaactagtgaagcaactaagagaaaatgttaagtctg
  • Show more
Description: A cloning plasmid for the SRP54 gene.

SRP54 cloning plasmid

CSB-CL022675HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1515
  • Sequence: atggttctagcagaccttggaagaaaaataacatcagcattacgctcattgagcaatgccaccattatcaatgaagaggtattgaatgctatgctaaaagaagtctgtaccgctttgttggaagcagatgttaatattaaactagtgaagcaactaagagaaaatgttaagtctg
  • Show more
Description: A cloning plasmid for the SRP54 gene.

pCMV-SPORT6-SRP54

PVT12424 2 ug
EUR 391

pCMV-SPORT6-SRP54

PVT18220 2 ug
EUR 231

Anti-SRP54 (2G7)

YF-MA15608 100 ug
EUR 363
Description: Mouse monoclonal to SRP54

Human SRP54 ELISA KIT

ELI-29458h 96 Tests
EUR 824

SRP54 ELISA KIT|Human

EF003237 96 Tests
EUR 689

Canine SRP54 ELISA KIT

ELI-52679d 96 Tests
EUR 928

Bovine SRP54 ELISA KIT

ELI-53441b 96 Tests
EUR 928

Rat SRP54 shRNA Plasmid

20-abx987313
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SRP54 shRNA Plasmid

20-abx954596
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Srp54 ELISA KIT

ELI-41414m 96 Tests
EUR 865

SRP54 Recombinant Protein (Rat)

RP231059 100 ug Ask for price

pECMV-3-FLAG-SRP54

PVT13001 2 ug
EUR 325

SRP54 Recombinant Protein (Human)

RP030088 100 ug Ask for price

SRP54 Rabbit Polyclonal Antibody