RXRB Rabbit Polyclonal Antibody

RXRB Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

RXRB Polyclonal Antibody
ABP60286-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human RXRB protein at amino acid sequence of 340-420 Applications tips:
Description: A polyclonal antibody for detection of RXRB from Human, Mouse, Rat. This RXRB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RXRB protein at amino acid sequence of 340-420

RXRB Polyclonal Antibody
ABP60286-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human RXRB protein at amino acid sequence of 340-420 Applications tips:
Description: A polyclonal antibody for detection of RXRB from Human, Mouse, Rat. This RXRB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RXRB protein at amino acid sequence of 340-420

RXRB Polyclonal Antibody
ABP60286-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human RXRB protein at amino acid sequence of 340-420 Applications tips:
Description: A polyclonal antibody for detection of RXRB from Human, Mouse, Rat. This RXRB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RXRB protein at amino acid sequence of 340-420

RXRB Polyclonal Antibody
ES10158-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against RXRB from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RXRB Polyclonal Antibody
ES10158-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against RXRB from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RXRB Rabbit pAb
A18119-100ul	Abclonal	100 ul	EUR 308

RXRB Rabbit pAb
A18119-200ul	Abclonal	200 ul	EUR 459

RXRB Rabbit pAb
A18119-20ul	Abclonal	20 ul	EUR 183

RXRB Rabbit pAb
A18119-50ul	Abclonal	50 ul	EUR 223

RXRB Polyclonal Conjugated Antibody
C30315	SAB	100ul	EUR 397

RXRB antibody
70R-1919	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal RXRB antibody raised against the N terminal of RXRB

RXRB antibody
70R-1920	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal RXRB antibody raised against the N terminal of RXRB

RXRB antibody
70R-12846	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal RXRB antibody

RXRB antibody
70R-20053	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal RXRB antibody

RXRB antibody
10R-8379	Fitzgerald	100 ul	EUR 392
Description: Mouse monoclonal RXRB antibody

RXRB Antibody
1-CSB-PA020613GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RXRB. Recognizes RXRB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Rxrb/ Rat Rxrb ELISA Kit
ELI-19900r	Lifescience Market	96 Tests	EUR 886

anti- RXRB antibody
FNab07544	FN Test	100µg	EUR 548.75
Immunogen: retinoid X receptor, beta Uniprot ID: P28702 Gene ID: 6257 Research Area: Stem Cells, Signal Transduction, Metabolism
Description: Antibody raised against RXRB

Anti-RXRB antibody
PAab07544	Lifescience Market	100 ug	EUR 386

Anti-RXRB antibody
STJ11100090	St John's Laboratory	100 µl	EUR 277

Anti-RXRB antibody
STJ191316	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to RXRB

RXRB siRNA
20-abx932324	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RXRB siRNA
20-abx932325	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RXRB Blocking Peptide
33R-6089	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RXRB antibody, catalog no. 70R-1919

RXRB Blocking Peptide
33R-7103	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RXRB antibody, catalog no. 70R-1920

RXRB cloning plasmid
CSB-CL020613HU-10ug	Cusabio	10ug	EUR 558
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1602 Sequence: atgtcttgggccgctcgcccgcccttcctccctcagcggcatgccgcagggcagtgtgggccggtgggggtgcgaaaagaaatgcattgtggggtcgcgtcccggtggcggcggcgacggccctggctggatcccgcagcggcggcggcggcggcggtggcaggcggagaacaac Show more
Description: A cloning plasmid for the RXRB gene.

pDONR223-RXRB Plasmid
PVTB01093-1	Lifescience Market	2 ug	EUR 356

Monoclonal RXRB Antibody (Hinge Peptide)
AMM02172G	Leading Biology	0.05ml	EUR 484
Description: A Monoclonal antibody against Human RXRB (Hinge Peptide). The antibodies are raised in Mouse. This antibody is applicable in WB and IHC-P

Human RXRB ELISA Kit
ELA-E10636h	Lifescience Market	96 Tests	EUR 824

Canine RXRB ELISA KIT
ELI-29420d	Lifescience Market	96 Tests	EUR 928

RXRB ELISA KIT|Human
EF002637	Lifescience Market	96 Tests	EUR 689

Mouse RXRB shRNA Plasmid
20-abx972540	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human RXRB shRNA Plasmid
20-abx954213	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RXRB Recombinant Protein (Human)
RP027463	ABM	100 ug	Ask for price

RXRB Recombinant Protein (Rat)
RP227324	ABM	100 ug	Ask for price

RXRB Recombinant Protein (Mouse)
RP169748	ABM	100 ug	Ask for price

RXRB Recombinant Protein (Mouse)
RP169751	ABM	100 ug	Ask for price

RXRB Recombinant Protein (Mouse)
RP169754	ABM	100 ug	Ask for price

RXRB Recombinant Protein (Mouse)
RP169757	ABM	100 ug	Ask for price

Retinoic Acid Receptor RXR-Beta (RXRB) Antibody
abx034505-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Retinoic Acid Receptor RXR-Beta (RXRB) Antibody
abx034505-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Retinoic Acid Receptor RXR-Beta (RXRB) Antibody
abx237544-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Monoclonal RXRB Antibody (monoclonal) (M01), Clone: 3C8
AMM04056G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human RXRB (monoclonal) (M01). The antibodies are raised in mouse and are from clone 3C8. This antibody is applicable in WB

Rxrb ORF Vector (Rat) (pORF)
ORF075776	ABM	1.0 ug DNA	EUR 506

RXRB ORF Vector (Human) (pORF)
ORF009155	ABM	1.0 ug DNA	EUR 95

Rxrb ORF Vector (Mouse) (pORF)
ORF056584	ABM	1.0 ug DNA	EUR 506

Rxrb ORF Vector (Mouse) (pORF)
ORF056585	ABM	1.0 ug DNA	EUR 506

Rxrb ORF Vector (Mouse) (pORF)
ORF056586	ABM	1.0 ug DNA	EUR 506

Rxrb ORF Vector (Mouse) (pORF)
ORF056587	ABM	1.0 ug DNA	EUR 506

RXRB ELISA Kit (Dog) (OKEH07629)
OKEH07629	Aviva Systems Biology	96 Wells	EUR 1184
Description: Description of target: ;Species reactivity: Dog;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

RXRB ELISA Kit (Human) (OKEH02105)
OKEH02105	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: This gene encodes a member of the retinoid X receptor (RXR) family of nuclear receptors which are involved in mediating the effects of retinoic acid (RA). The encoded protein forms homodimers with the retinoic acid, thyroid hormone, and vitamin D receptors, increasing both DNA binding and transcriptional function on their respective response elements. This gene lies within the major histocompatibility complex (MHC) class II region on chromosome 6. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.27 ng/mL

RXRB ELISA Kit (Mouse) (OKEH03597)
OKEH03597	Aviva Systems Biology	96 Wells	EUR 844
Description: Description of target: Receptor for retinoic acid. Retinoic acid receptors bind as heterodimers to their target response elements in response to their ligands, all-trans or 9-cis retinoic acid, and regulate gene expression in various biological processes. The RAR/RXR heterodimers bind to the retinoic acid response elements (RARE).;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.165 ng/mL

Rxrb sgRNA CRISPR Lentivector set (Rat)
K7235401	ABM	3 x 1.0 ug	EUR 339

Rxrb sgRNA CRISPR Lentivector set (Mouse)
K3348601	ABM	3 x 1.0 ug	EUR 339

RXRB sgRNA CRISPR Lentivector set (Human)
K2080601	ABM	3 x 1.0 ug	EUR 339

Rxrb sgRNA CRISPR Lentivector (Rat) (Target 1)
K7235402	ABM	1.0 ug DNA	EUR 154

Rxrb sgRNA CRISPR Lentivector (Rat) (Target 2)
K7235403	ABM	1.0 ug DNA	EUR 154

Rxrb sgRNA CRISPR Lentivector (Rat) (Target 3)
K7235404	ABM	1.0 ug DNA	EUR 154

Rxrb sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3348602	ABM	1.0 ug DNA	EUR 154

Rxrb sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3348603	ABM	1.0 ug DNA	EUR 154

Rxrb sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3348604	ABM	1.0 ug DNA	EUR 154

RXRB sgRNA CRISPR Lentivector (Human) (Target 1)
K2080602	ABM	1.0 ug DNA	EUR 154

RXRB sgRNA CRISPR Lentivector (Human) (Target 2)
K2080603	ABM	1.0 ug DNA	EUR 154

RXRB sgRNA CRISPR Lentivector (Human) (Target 3)
K2080604	ABM	1.0 ug DNA	EUR 154

RXRB Protein Vector (Rat) (pPB-C-His)
PV303102	ABM	500 ng	EUR 603

RXRB Protein Vector (Rat) (pPB-N-His)
PV303103	ABM	500 ng	EUR 603

RXRB Protein Vector (Rat) (pPM-C-HA)
PV303104	ABM	500 ng	EUR 603

RXRB Protein Vector (Rat) (pPM-C-His)
PV303105	ABM	500 ng	EUR 603

RXRB Protein Vector (Mouse) (pPB-C-His)
PV226334	ABM	500 ng	EUR 603

RXRB Protein Vector (Mouse) (pPB-N-His)
PV226335	ABM	500 ng	EUR 603

RXRB Protein Vector (Mouse) (pPM-C-HA)
PV226336	ABM	500 ng	EUR 603

RXRB Protein Vector (Mouse) (pPM-C-His)
PV226337	ABM	500 ng	EUR 603

RXRB Protein Vector (Mouse) (pPB-C-His)
PV226338	ABM	500 ng	EUR 603

RXRB Protein Vector (Mouse) (pPB-N-His)
PV226339	ABM	500 ng	EUR 603

RXRB Protein Vector (Mouse) (pPM-C-HA)
PV226340	ABM	500 ng	EUR 603

RXRB Protein Vector (Mouse) (pPM-C-His)
PV226341	ABM	500 ng	EUR 603

RXRB Protein Vector (Mouse) (pPB-C-His)
PV226342	ABM	500 ng	EUR 603

RXRB Protein Vector (Mouse) (pPB-N-His)
PV226343	ABM	500 ng	EUR 603

RXRB Protein Vector (Mouse) (pPM-C-HA)
PV226344	ABM	500 ng	EUR 603

RXRB Protein Vector (Mouse) (pPM-C-His)
PV226345	ABM	500 ng	EUR 603

RXRB Protein Vector (Mouse) (pPB-C-His)
PV226346	ABM	500 ng	EUR 603

RXRB Protein Vector (Mouse) (pPB-N-His)
PV226347	ABM	500 ng	EUR 603

RXRB Protein Vector (Mouse) (pPM-C-HA)
PV226348	ABM	500 ng	EUR 603

RXRB Protein Vector (Mouse) (pPM-C-His)
PV226349	ABM	500 ng	EUR 603

RXRB Protein Vector (Human) (pPB-C-His)
PV036617	ABM	500 ng	EUR 329

RXRB Protein Vector (Human) (pPB-N-His)
PV036618	ABM	500 ng	EUR 329

RXRB Protein Vector (Human) (pPM-C-HA)
PV036619	ABM	500 ng	EUR 329

RXRB Protein Vector (Human) (pPM-C-His)
PV036620	ABM	500 ng	EUR 329

Rxrb 3'UTR Luciferase Stable Cell Line
TU118278	ABM	1.0 ml	Ask for price

Rxrb 3'UTR GFP Stable Cell Line
TU168278	ABM	1.0 ml	Ask for price

Rxrb 3'UTR Luciferase Stable Cell Line
TU219861	ABM	1.0 ml	Ask for price

Rxrb 3'UTR GFP Stable Cell Line
TU269861	ABM	1.0 ml	Ask for price

RXRB 3'UTR GFP Stable Cell Line
TU072502	ABM	1.0 ml	EUR 1521

RXRB 3'UTR Luciferase Stable Cell Line
TU022502	ABM	1.0 ml	EUR 1521

RXRB Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV696955	ABM	1.0 ug DNA	EUR 682

RXRB Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV696959	ABM	1.0 ug DNA	EUR 682

RXRB Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV696960	ABM	1.0 ug DNA	EUR 682

Mouse Retinoid X Receptor Beta (RXRb) ELISA Kit
QY-E21661	Qayee Biotechnology	96T	EUR 374

RXRB Rabbit Polyclonal Antibody