October 17, 2021

RSPH1 Rabbit Polyclonal Antibody

RSPH1 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

RSPH1 Polyclonal Antibody
ABP60270-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RSPH1 protein at amino acid sequence of 50-130
  • Applications tips:
Description: A polyclonal antibody for detection of RSPH1 from Human, Mouse. This RSPH1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RSPH1 protein at amino acid sequence of 50-130
RSPH1 Polyclonal Antibody
ABP60270-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RSPH1 protein at amino acid sequence of 50-130
  • Applications tips:
Description: A polyclonal antibody for detection of RSPH1 from Human, Mouse. This RSPH1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RSPH1 protein at amino acid sequence of 50-130
RSPH1 Polyclonal Antibody
ES10085-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RSPH1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
RSPH1 Polyclonal Antibody
ES10085-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RSPH1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
RSPH1 Antibody
43368-100ul 100ul
EUR 252
RSPH1 Conjugated Antibody
C43368 100ul
EUR 397
Anti-RSPH1 antibody
STJ191243 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RSPH1
RSPH1 siRNA
20-abx932200
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RSPH1 siRNA
20-abx932201
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RSPH1 cloning plasmid
CSB-CL823913HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 930
  • Sequence: ATGTCGGACCTGGGCTCGGAGGAGTTGGAGGAGGAGGGAGAGAATGATATTGGGGAATATGAGGGGGGTCGGAATGAGGCAGGCGAAAGGCACGGACGTGGGAGGGCACGGCTACCCAACGGGGACACCTACGAAGGGAGCTACGAATTCGGTAAAAGACATGGCCAGGGGATCTA
  • Show more
Description: A cloning plasmid for the RSPH1 gene.
Mouse RSPH1 shRNA Plasmid
20-abx973234
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human RSPH1 shRNA Plasmid
20-abx963848
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
RSPH1 Recombinant Protein (Human)
RP043042 100 ug Ask for price
RSPH1 Recombinant Protein (Mouse)
RP169463 100 ug Ask for price
RSPH1 Recombinant Protein (Rat)
RP227012 100 ug Ask for price
Rsph1 ORF Vector (Rat) (pORF)
ORF075672 1.0 ug DNA
EUR 506
RSPH1 ORF Vector (Human) (pORF)
ORF014348 1.0 ug DNA
EUR 354
Rsph1 ORF Vector (Mouse) (pORF)
ORF056489 1.0 ug DNA
EUR 506
Rsph1 sgRNA CRISPR Lentivector set (Mouse)
K4938801 3 x 1.0 ug
EUR 339
Rsph1 sgRNA CRISPR Lentivector set (Rat)
K6384201 3 x 1.0 ug
EUR 339
RSPH1 sgRNA CRISPR Lentivector set (Human)
K2073801 3 x 1.0 ug
EUR 339
Rsph1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4938802 1.0 ug DNA
EUR 154
Rsph1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4938803 1.0 ug DNA
EUR 154
Rsph1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4938804 1.0 ug DNA
EUR 154
Rsph1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6384202 1.0 ug DNA
EUR 154
Rsph1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6384203 1.0 ug DNA
EUR 154
Rsph1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6384204 1.0 ug DNA
EUR 154
RSPH1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2073802 1.0 ug DNA
EUR 154
RSPH1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2073803 1.0 ug DNA
EUR 154
RSPH1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2073804 1.0 ug DNA
EUR 154
RSPH1 Protein Vector (Rat) (pPB-C-His)
PV302686 500 ng
EUR 603
RSPH1 Protein Vector (Rat) (pPB-N-His)
PV302687 500 ng
EUR 603
RSPH1 Protein Vector (Rat) (pPM-C-HA)
PV302688 500 ng
EUR 603
RSPH1 Protein Vector (Rat) (pPM-C-His)
PV302689 500 ng
EUR 603
RSPH1 Protein Vector (Human) (pPB-C-His)
PV057389 500 ng
EUR 481
RSPH1 Protein Vector (Human) (pPB-N-His)
PV057390 500 ng
EUR 481
RSPH1 Protein Vector (Human) (pPM-C-HA)
PV057391 500 ng
EUR 481
RSPH1 Protein Vector (Human) (pPM-C-His)
PV057392 500 ng
EUR 481
RSPH1 Protein Vector (Mouse) (pPB-C-His)
PV225954 500 ng
EUR 603
RSPH1 Protein Vector (Mouse) (pPB-N-His)
PV225955 500 ng
EUR 603
RSPH1 Protein Vector (Mouse) (pPM-C-HA)
PV225956 500 ng
EUR 603
RSPH1 Protein Vector (Mouse) (pPM-C-His)
PV225957 500 ng
EUR 603
Rsph1 3'UTR Luciferase Stable Cell Line
TU118217 1.0 ml Ask for price

RSPH1 Rabbit Polyclonal Antibody