RSPH1 Rabbit Polyclonal Antibody

RSPH1 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

RSPH1 Polyclonal Antibody
ABP60270-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human RSPH1 protein at amino acid sequence of 50-130 Applications tips:
Description: A polyclonal antibody for detection of RSPH1 from Human, Mouse. This RSPH1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RSPH1 protein at amino acid sequence of 50-130

RSPH1 Polyclonal Antibody
ABP60270-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human RSPH1 protein at amino acid sequence of 50-130 Applications tips:
Description: A polyclonal antibody for detection of RSPH1 from Human, Mouse. This RSPH1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RSPH1 protein at amino acid sequence of 50-130

RSPH1 Polyclonal Antibody
ES10085-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against RSPH1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

RSPH1 Polyclonal Antibody
ES10085-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against RSPH1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

RSPH1 Antibody
43368-100ul	SAB	100ul	EUR 252

RSPH1 Conjugated Antibody
C43368	SAB	100ul	EUR 397

Anti-RSPH1 antibody
STJ191243	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to RSPH1

RSPH1 siRNA
20-abx932200	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RSPH1 siRNA
20-abx932201	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RSPH1 cloning plasmid
CSB-CL823913HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 930 Sequence: ATGTCGGACCTGGGCTCGGAGGAGTTGGAGGAGGAGGGAGAGAATGATATTGGGGAATATGAGGGGGGTCGGAATGAGGCAGGCGAAAGGCACGGACGTGGGAGGGCACGGCTACCCAACGGGGACACCTACGAAGGGAGCTACGAATTCGGTAAAAGACATGGCCAGGGGATCTA Show more
Description: A cloning plasmid for the RSPH1 gene.

Mouse RSPH1 shRNA Plasmid
20-abx973234	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human RSPH1 shRNA Plasmid
20-abx963848	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RSPH1 Recombinant Protein (Human)
RP043042	ABM	100 ug	Ask for price

RSPH1 Recombinant Protein (Mouse)
RP169463	ABM	100 ug	Ask for price

RSPH1 Recombinant Protein (Rat)
RP227012	ABM	100 ug	Ask for price

Rsph1 ORF Vector (Rat) (pORF)
ORF075672	ABM	1.0 ug DNA	EUR 506

RSPH1 ORF Vector (Human) (pORF)
ORF014348	ABM	1.0 ug DNA	EUR 354

Rsph1 ORF Vector (Mouse) (pORF)
ORF056489	ABM	1.0 ug DNA	EUR 506

Rsph1 sgRNA CRISPR Lentivector set (Mouse)
K4938801	ABM	3 x 1.0 ug	EUR 339

Rsph1 sgRNA CRISPR Lentivector set (Rat)
K6384201	ABM	3 x 1.0 ug	EUR 339

RSPH1 sgRNA CRISPR Lentivector set (Human)
K2073801	ABM	3 x 1.0 ug	EUR 339

Rsph1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4938802	ABM	1.0 ug DNA	EUR 154

Rsph1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4938803	ABM	1.0 ug DNA	EUR 154

Rsph1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4938804	ABM	1.0 ug DNA	EUR 154

Rsph1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6384202	ABM	1.0 ug DNA	EUR 154

Rsph1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6384203	ABM	1.0 ug DNA	EUR 154

Rsph1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6384204	ABM	1.0 ug DNA	EUR 154

RSPH1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2073802	ABM	1.0 ug DNA	EUR 154

RSPH1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2073803	ABM	1.0 ug DNA	EUR 154

RSPH1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2073804	ABM	1.0 ug DNA	EUR 154

RSPH1 Protein Vector (Rat) (pPB-C-His)
PV302686	ABM	500 ng	EUR 603

RSPH1 Protein Vector (Rat) (pPB-N-His)
PV302687	ABM	500 ng	EUR 603

RSPH1 Protein Vector (Rat) (pPM-C-HA)
PV302688	ABM	500 ng	EUR 603

RSPH1 Protein Vector (Rat) (pPM-C-His)
PV302689	ABM	500 ng	EUR 603

RSPH1 Protein Vector (Human) (pPB-C-His)
PV057389	ABM	500 ng	EUR 481

RSPH1 Protein Vector (Human) (pPB-N-His)
PV057390	ABM	500 ng	EUR 481

RSPH1 Protein Vector (Human) (pPM-C-HA)
PV057391	ABM	500 ng	EUR 481

RSPH1 Protein Vector (Human) (pPM-C-His)
PV057392	ABM	500 ng	EUR 481

RSPH1 Protein Vector (Mouse) (pPB-C-His)
PV225954	ABM	500 ng	EUR 603

RSPH1 Protein Vector (Mouse) (pPB-N-His)
PV225955	ABM	500 ng	EUR 603

RSPH1 Protein Vector (Mouse) (pPM-C-HA)
PV225956	ABM	500 ng	EUR 603

RSPH1 Protein Vector (Mouse) (pPM-C-His)
PV225957	ABM	500 ng	EUR 603

Rsph1 3'UTR Luciferase Stable Cell Line
TU118217	ABM	1.0 ml	Ask for price

RSPH1 Rabbit Polyclonal Antibody