October 17, 2021

TBX15 Rabbit Polyclonal Antibody

TBX15 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

Tbx15 Polyclonal Antibody
A63544 100 µg
EUR 570.55
Description: Ask the seller for details
TBX15 Polyclonal Antibody
ABP60634-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human TBX15 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TBX15 from Human, Mouse. This TBX15 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TBX15 protein
TBX15 Polyclonal Antibody
ABP60634-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human TBX15 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TBX15 from Human, Mouse. This TBX15 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TBX15 protein
TBX15 Polyclonal Antibody
ABP60634-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human TBX15 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TBX15 from Human, Mouse. This TBX15 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TBX15 protein
TBX15 Polyclonal Antibody
ES10345-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TBX15 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
TBX15 Polyclonal Antibody
ES10345-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TBX15 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
TBX15/18 Polyclonal Antibody
ABP52568-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human TBX15/18 at AA range: 130-210
  • Applications tips:
Description: A polyclonal antibody for detection of TBX15/18 from Human, Mouse. This TBX15/18 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human TBX15/18 at AA range: 130-210
TBX15/18 Polyclonal Antibody
ABP52568-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human TBX15/18 at AA range: 130-210
  • Applications tips:
Description: A polyclonal antibody for detection of TBX15/18 from Human, Mouse. This TBX15/18 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human TBX15/18 at AA range: 130-210
TBX15/18 Polyclonal Antibody
ABP52568-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human TBX15/18 at AA range: 130-210
  • Applications tips:
Description: A polyclonal antibody for detection of TBX15/18 from Human, Mouse. This TBX15/18 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human TBX15/18 at AA range: 130-210
TBX15/18 Polyclonal Antibody
ES3567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TBX15/18 from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA
TBX15/18 Polyclonal Antibody
ES3567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TBX15/18 from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA
TBX15 antibody
20R-1270 100 ug
EUR 377
Description: Rabbit polyclonal TBX15 antibody
TBX15 Antibody
1-CSB-PA839414HA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBX15. Recognizes TBX15 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000
TBX15 antibody
70R-8761 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal TBX15 antibody
Tbx15 Antibody
1-CSB-PA023247LA01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Tbx15. Recognizes Tbx15 from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA
TBX15 Polyclonal Antibody, Biotin Conjugated
A61259 100 µg
EUR 570.55
Description: Ask the seller for details
TBX15 Polyclonal Antibody, FITC Conjugated
A61260 100 µg
EUR 570.55
Description: The best epigenetics products
TBX15 Polyclonal Antibody, HRP Conjugated
A61261 100 µg
EUR 570.55
Description: kits suitable for this type of research
Tbx15 Polyclonal Antibody, HRP Conjugated
A63545 100 µg
EUR 570.55
Description: The best epigenetics products
Tbx15 Polyclonal Antibody, FITC Conjugated
A63546 100 µg
EUR 570.55
Description: kits suitable for this type of research
Tbx15 Polyclonal Antibody, Biotin Conjugated
A63547 100 µg
EUR 570.55
Description: fast delivery possible
T-box 15 (TBX15) polyclonal antibody
ABP-PAB-11247 100 ug Ask for price
    • Product line: Transcription Factors
    • Brand:
TBX15/18 Antibody
33639-100ul 100ul
EUR 252
TBX15/18 Antibody
33639-50ul 50ul
EUR 187
TBX18/TBX15 Antibody
1-CSB-PA004240
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TBX18/TBX15. Recognizes TBX18/TBX15 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000
TBX15/18 Antibody
DF8727 200ul
EUR 304
Description: TBX15/18 Antibody detects endogenous levels of total TBX15/18.
TBX15/TBX18 Antibody
CSB-PA205481-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TBX15/TBX18. Recognizes TBX15/TBX18 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500
TBX15/TBX18 Antibody
CSB-PA205481-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TBX15/TBX18. Recognizes TBX15/TBX18 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500
TBX15/18 antibody
70R-50670 100 ul
EUR 244
Description: Purified Polyclonal TBX15/18 antibody
TBX15/18 antibody
70R-33773 100 ug
EUR 327
Description: Rabbit polyclonal TBX15/18 antibody
TBX15 / TBX18 Antibody
abx331522-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.
TBX18 / TBX15 Antibody
20-abx326152
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
TBX15/18 Antibody
ABD8727 100 ug
EUR 438
anti- TBX15 antibody
FNab08534 100µg
EUR 585
  • Immunogen: T-box 15
  • Uniprot ID: Q96SF7
  • Gene ID: 6913
  • Research Area: Metabolism, Developmental biology
Description: Antibody raised against TBX15
Anti-TBX15 antibody
PAab08534 100 ug
EUR 412
Anti-TBX15 antibody
STJ191503 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TBX15
TBX15 siRNA
20-abx936254
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TBX15 siRNA
20-abx936255
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
T-Box Transcription Factor TBX15/18 (TBX15/18) Antibody
20-abx013348
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.
Anti-TBX15/18 Antibody
A08871 100ul
EUR 397
Description: Rabbit Polyclonal TBX15/18 Antibody. Validated in IF, IHC, WB and tested in Human, Mouse.
Anti-TBX15/18 Antibody
A06044-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for TBX15/18 Antibody (TBX18) detection.tested for WB in Human, Mouse.
TBX15 Antibody, HRP conjugated
1-CSB-PA839414HB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBX15. Recognizes TBX15 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
TBX15 Antibody, FITC conjugated
1-CSB-PA839414HC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBX15. Recognizes TBX15 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
TBX15 Antibody, Biotin conjugated
1-CSB-PA839414HD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBX15. Recognizes TBX15 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
TBX15/18 Conjugated Antibody
C33639 100ul
EUR 397
Tbx15 Antibody, HRP conjugated
1-CSB-PA023247LB01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Tbx15. Recognizes Tbx15 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA
Tbx15 Antibody, FITC conjugated
1-CSB-PA023247LC01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Tbx15. Recognizes Tbx15 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA
Tbx15 Antibody, Biotin conjugated
1-CSB-PA023247LD01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Tbx15. Recognizes Tbx15 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA
Anti-TBX15/18 antibody
STJ95931 200 µl
EUR 197
Description: Rabbit polyclonal to TBX15/18.
Human T-box transcription factor TBX15 (TBX15)
1-CSB-EP839414HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 70.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human T-box transcription factor TBX15(TBX15) expressed in E.coli
TBX15 Blocking Peptide
33R-10115 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TBX15 antibody, catalog no. 20R-1270
TBX15 Blocking Peptide
33R-8862 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TBX15 antibody, catalog no. 70R-8761
TBX15 cloning plasmid
CSB-CL839414HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1491
  • Sequence: ATGTCTTCCATGGAGGAGATTCAGGTGGAGCTGCAATGTGCTGACCTCTGGAAGCGGTTCCATGATATTGGAACTGAAATGATCATCACCAAAGCAGGCAGGAGGATGTTTCCTGCCATGAGAGTGAAAATCACTGGCCTAGATCCACATCAGCAGTACTACATAGCAATGGACA
  • Show more
Description: A cloning plasmid for the TBX15 gene.
Mouse T- box transcription factor TBX15, Tbx15 ELISA KIT
ELI-13736m 96 Tests
EUR 865
Human T- box transcription factor TBX15, TBX15 ELISA KIT
ELI-41427h 96 Tests
EUR 824
TBX15/18 Blocking Peptide
DF8727-BP 1mg
EUR 195
TBX15 ELISA KIT|Human
EF003481 96 Tests
EUR 689
Mouse TBX15 shRNA Plasmid
20-abx973005
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human TBX15 shRNA Plasmid
20-abx954738
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TBX15 Recombinant Protein (Rat)
RP232511 100 ug Ask for price
TBX15 Recombinant Protein (Human)
RP044029 100 ug Ask for price
TBX15 Recombinant Protein (Mouse)
RP177650 100 ug Ask for price
T-Box Protein 15 (TBX15) Antibody
abx122856-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
T-Box Protein 15 (TBX15) Antibody
abx030360-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
T-Box Protein 15 (TBX15) Antibody
abx030360-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
T-Box Protein 15 (TBX15) Antibody
abx238534-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
T-Box Protein 15 (Tbx15) Antibody
20-abx319107
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
T-Box Protein 15 (TBX15) Antibody
20-abx309391
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
T-Box Protein 15 (Tbx15) Antibody (HRP)
20-abx319108
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
T-Box Protein 15 (Tbx15) Antibody (FITC)
20-abx319109
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
T-Box Protein 15 (Tbx15) Antibody (Biotin)
20-abx319110
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
T-Box Protein 15 (TBX15) Antibody (HRP)
20-abx309392
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
T-Box Protein 15 (TBX15) Antibody (FITC)
20-abx309393
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
T-Box Protein 15 (TBX15) Antibody (Biotin)
20-abx309394
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
TBX15 / 18 Cell ELISA Kit
abx595695-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.
Tbx15 ORF Vector (Rat) (pORF)
ORF077505 1.0 ug DNA
EUR 506
TBX15 ORF Vector (Human) (pORF)
ORF014677 1.0 ug DNA
EUR 354
Tbx15 ORF Vector (Mouse) (pORF)
ORF059218 1.0 ug DNA
EUR 506
TBX15/18 Colorimetric Cell-Based ELISA
EKC1664 100ul
EUR 572
Tbx15 sgRNA CRISPR Lentivector set (Rat)
K6094901 3 x 1.0 ug
EUR 339
Tbx15 sgRNA CRISPR Lentivector set (Mouse)
K3902501 3 x 1.0 ug
EUR 339
TBX15 sgRNA CRISPR Lentivector set (Human)
K2344801 3 x 1.0 ug
EUR 339
Tbx15 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6094902 1.0 ug DNA
EUR 154
Tbx15 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6094903 1.0 ug DNA
EUR 154
Tbx15 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6094904 1.0 ug DNA
EUR 154
Tbx15 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3902502 1.0 ug DNA
EUR 154
Tbx15 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3902503 1.0 ug DNA
EUR 154
Tbx15 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3902504 1.0 ug DNA
EUR 154
TBX15 sgRNA CRISPR Lentivector (Human) (Target 1)
K2344802 1.0 ug DNA
EUR 154
TBX15 sgRNA CRISPR Lentivector (Human) (Target 2)
K2344803 1.0 ug DNA
EUR 154
TBX15 sgRNA CRISPR Lentivector (Human) (Target 3)
K2344804 1.0 ug DNA
EUR 154
TBX15 Protein Vector (Rat) (pPB-C-His)
PV310018 500 ng
EUR 603
TBX15 Protein Vector (Rat) (pPB-N-His)
PV310019 500 ng
EUR 603
TBX15 Protein Vector (Rat) (pPM-C-HA)
PV310020 500 ng
EUR 603
TBX15 Protein Vector (Rat) (pPM-C-His)
PV310021 500 ng
EUR 603
TBX15 Protein Vector (Human) (pPB-C-His)
PV058705 500 ng
EUR 481
TBX15 Protein Vector (Human) (pPB-N-His)
PV058706 500 ng
EUR 481
TBX15 Protein Vector (Human) (pPM-C-HA)
PV058707 500 ng
EUR 481
TBX15 Protein Vector (Human) (pPM-C-His)
PV058708 500 ng
EUR 481
TBX15 Protein Vector (Mouse) (pPB-C-His)
PV236870 500 ng
EUR 603
TBX15 Protein Vector (Mouse) (pPB-N-His)
PV236871 500 ng
EUR 603
TBX15 Protein Vector (Mouse) (pPM-C-HA)
PV236872 500 ng
EUR 603
TBX15 Protein Vector (Mouse) (pPM-C-His)
PV236873 500 ng
EUR 603
Tbx15 3'UTR Luciferase Stable Cell Line
TU120237 1.0 ml Ask for price
Tbx15 3'UTR GFP Stable Cell Line
TU170237 1.0 ml Ask for price
Tbx15 3'UTR Luciferase Stable Cell Line
TU221666 1.0 ml Ask for price
TBX15 3'UTR GFP Stable Cell Line
TU075254 1.0 ml
EUR 1521
Tbx15 3'UTR GFP Stable Cell Line
TU271666 1.0 ml Ask for price
TBX15 3'UTR Luciferase Stable Cell Line
TU025254 1.0 ml
EUR 1521
Human T-Box protein 15 (TBX15) ELISA Kit
abx383659-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
TBX15/18 Colorimetric Cell-Based ELISA Kit (OKAG01184)
OKAG01184 96 Wells
EUR 596
Description: Description of target: ;Species reactivity: Human, Mouse;Application: ELISA;Assay info: Assay Type: Cell-Based
Subtype: None
Detection Method: Colorimetric 450 nm;Sensitivity:
GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252
GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187
EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252
EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187
Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252
Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187
ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252
ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187
EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252
EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187
mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252
mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187
mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252
mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187
AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252
AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187
EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252
EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187
Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252
Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187
LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252
LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187
GAPDH Rabbit Polyclonal Antibody
A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
Rabbit Hemoglobin Polyclonal Antibody
A53073 100 µg
EUR 570.55
Description: The best epigenetics products
Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
NM23A Rabbit Polyclonal Antibody
ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
ATM Rabbit Polyclonal Antibody
ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

TBX15 Rabbit Polyclonal Antibody