TRPC7 Rabbit Polyclonal Antibody
To Order Contact us: [email protected]
 TRPC7 Polyclonal Antibody |
|
ABP60768-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human TRPC7 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of TRPC7 from Human, Mouse. This TRPC7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TRPC7 protein |
TRPC7 Polyclonal Antibody |
|
ABP60768-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human TRPC7 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of TRPC7 from Human, Mouse. This TRPC7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TRPC7 protein |
TRPC7 Polyclonal Antibody |
|
ABP60768-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human TRPC7 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of TRPC7 from Human, Mouse. This TRPC7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TRPC7 protein |
 TRPC7 Rabbit pAb |
|
A17738-100ul |
Abclonal |
100 ul |
EUR 308 |
TRPC7 Rabbit pAb |
|
A17738-200ul |
Abclonal |
200 ul |
EUR 459 |
TRPC7 Rabbit pAb |
|
A17738-20ul |
Abclonal |
20 ul |
EUR 183 |
TRPC7 Rabbit pAb |
|
A17738-50ul |
Abclonal |
50 ul |
EUR 223 |
 Antibody) Polyclonal TRPC7 (extracellular) Antibody |
|
AMM08351G |
Leading Biology |
0.05ml |
EUR 659 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRPC7 (extracellular) . This antibody is tested and proven to work in the following applications: |
 TRPC7 Antibody |
|
35976-100ul |
SAB |
100ul |
EUR 252 |
TRPC7 Antibody |
|
1-CSB-PA954426 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against TRPC7. Recognizes TRPC7 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
) Polyclonal TRPC7 Antibody (internal region) |
|
AMM08353G |
Leading Biology |
0.1 mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TRPC7 (internal region). This antibody is tested and proven to work in the following applications: |
 TRPC7 Conjugated Antibody |
|
C35976 |
SAB |
100ul |
EUR 397 |
 Anti-TRPC7 antibody |
|
STJ191416 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to TRPC7 |
 TRPC7 siRNA |
|
20-abx938221 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TRPC7 siRNA |
|
20-abx938222 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Monoclonal antibody for TrpC7 |
|
SMC-343D |
Stressmarq |
0.1mg |
EUR 353 |
- Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
- Show more
|
|
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is not conjugated. |
Monoclonal antibody for TrpC7 |
|
SMC-343D-A390 |
Stressmarq |
0.1mg |
EUR 400 |
- Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
- Show more
|
|
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with ATTO 390. |
Monoclonal antibody for TrpC7 |
|
SMC-343D-A488 |
Stressmarq |
0.1mg |
EUR 399 |
- Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
- Show more
|
|
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with ATTO 488. |
Monoclonal antibody for TrpC7 |
|
SMC-343D-A565 |
Stressmarq |
0.1mg |
EUR 399 |
- Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
- Show more
|
|
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with ATTO 565. |
Monoclonal antibody for TrpC7 |
|
SMC-343D-A594 |
Stressmarq |
0.1mg |
EUR 399 |
- Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
- Show more
|
|
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with ATTO 594. |
Monoclonal antibody for TrpC7 |
|
SMC-343D-A633 |
Stressmarq |
0.1mg |
EUR 399 |
- Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
- Show more
|
|
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with ATTO 633. |
Monoclonal antibody for TrpC7 |
|
SMC-343D-A655 |
Stressmarq |
0.1mg |
EUR 399 |
- Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
- Show more
|
|
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with ATTO 655. |
Monoclonal antibody for TrpC7 |
|
SMC-343D-A680 |
Stressmarq |
0.1mg |
EUR 399 |
- Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
- Show more
|
|
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with ATTO 680. |
Monoclonal antibody for TrpC7 |
|
SMC-343D-A700 |
Stressmarq |
0.1mg |
EUR 399 |
- Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
- Show more
|
|
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with ATTO 700. |
Monoclonal antibody for TrpC7 |
|
SMC-343D-ALP |
Stressmarq |
0.1mg |
EUR 393 |
- Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
- Show more
|
|
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with Alkaline Phosphatase. |
Monoclonal antibody for TrpC7 |
|
SMC-343D-APC |
Stressmarq |
0.1mg |
EUR 398 |
- Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
- Show more
|
|
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with APC. |
Monoclonal antibody for TrpC7 |
|
SMC-343D-APCCY7 |
Stressmarq |
0.1mg |
EUR 470 |
- Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
- Show more
|
|
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with APC/Cy7. |
Monoclonal antibody for TrpC7 |
|
SMC-343D-BI |
Stressmarq |
0.1mg |
EUR 395 |
- Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
- Show more
|
|
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with Biotin. |
Monoclonal antibody for TrpC7 |
|
SMC-343D-DY350 |
Stressmarq |
0.1mg |
EUR 413 |
- Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
- Show more
|
|
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with Dylight 350. |
Monoclonal antibody for TrpC7 |
|
SMC-343D-DY405 |
Stressmarq |
0.1mg |
EUR 402 |
- Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
- Show more
|
|
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with Dylight 405. |
Monoclonal antibody for TrpC7 |
|
SMC-343D-DY488 |
Stressmarq |
0.1mg |
EUR 392 |
- Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
- Show more
|
|
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with Dylight 488. |
Monoclonal antibody for TrpC7 |
|
SMC-343D-DY594 |
Stressmarq |
0.1mg |
EUR 394 |
- Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
- Show more
|
|
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with Dylight 594. |
Monoclonal antibody for TrpC7 |
|
SMC-343D-DY633 |
Stressmarq |
0.1mg |
EUR 389 |
- Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
- Show more
|
|
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with Dylight 633. |
Monoclonal antibody for TrpC7 |
|
SMC-343D-FITC |
Stressmarq |
0.1mg |
EUR 391 |
- Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
- Show more
|
|
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with FITC. |
Monoclonal antibody for TrpC7 |
|
SMC-343D-HRP |
Stressmarq |
0.1mg |
EUR 387 |
- Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
- Show more
|
|
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with HRP. |
Monoclonal antibody for TrpC7 |
|
SMC-343D-P594 |
Stressmarq |
0.1mg |
EUR 406 |
- Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
- Show more
|
|
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with PE/ATTO 594. |
Monoclonal antibody for TrpC7 |
|
SMC-343D-PCP |
Stressmarq |
0.1mg |
EUR 398 |
- Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
- Show more
|
|
Description: A monoclonal antibody from clone S64A-36 against Human TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with PerCP. |
Monoclonal antibody for TrpC7 |
|
SMC-343D-RPE |
Stressmarq |
0.1mg |
EUR 396 |
- Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
- Show more
|
|
Description: A monoclonal antibody from clone S64A-36 against Human TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with RPE. |
Monoclonal antibody for TrpC7 |
|
SMC-343D-STR |
Stressmarq |
0.1mg |
EUR 397 |
- Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
- Show more
|
|
Description: A monoclonal antibody from clone S64A-36 against Human TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with Streptavidin. |
Monoclonal antibody for TrpC7 |
|
SMC-343S |
Stressmarq |
0.012mg |
EUR 65 |
- Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
- Show more
|
|
Description: A monoclonal antibody from clone S64A-36 against Human TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is not conjugated. |
 TRPC7 cloning plasmid |
|
CSB-CL888031HU-10ug |
Cusabio |
10ug |
EUR 558 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2589
- Sequence: ATGTTGAGGAACAGCACCTTCAAAAACATGCAGCGCCGGCACACAACGCTGAGGGAGAAGGGCCGTCGCCAGGCCATCCGGGGTCCCGCCTACATGTTCAACGAGAAGGGCACCAGTCTGACGCCCGAGGAGGAGCGCTTCCTGGACTCGGCTGAGTATGGCAACATCCCGGTGG
- Show more
|
|
Description: A cloning plasmid for the TRPC7 gene. |
 Anti-TRP 7/TRPC7 Antibody |
|
PB9272 |
BosterBio |
100ug/vial |
EUR 294 |
TRPC7 Rabbit Polyclonal Antibody
