October 23, 2021

TRPC7 Rabbit Polyclonal Antibody

TRPC7 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

TRPC7 Polyclonal Antibody

ABP60768-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human TRPC7 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TRPC7 from Human, Mouse. This TRPC7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TRPC7 protein

TRPC7 Polyclonal Antibody

ABP60768-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human TRPC7 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TRPC7 from Human, Mouse. This TRPC7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TRPC7 protein

TRPC7 Polyclonal Antibody

ABP60768-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human TRPC7 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TRPC7 from Human, Mouse. This TRPC7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TRPC7 protein

TRPC7 Rabbit pAb

A17738-100ul 100 ul
EUR 308

TRPC7 Rabbit pAb

A17738-200ul 200 ul
EUR 459

TRPC7 Rabbit pAb

A17738-20ul 20 ul
EUR 183

TRPC7 Rabbit pAb

A17738-50ul 50 ul
EUR 223

Polyclonal TRPC7 (extracellular) Antibody

AMM08351G 0.05ml
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRPC7 (extracellular) . This antibody is tested and proven to work in the following applications:

TRPC7 Antibody

35976-100ul 100ul
EUR 252

TRPC7 Antibody

1-CSB-PA954426
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TRPC7. Recognizes TRPC7 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

Polyclonal TRPC7 Antibody (internal region)

AMM08353G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TRPC7 (internal region). This antibody is tested and proven to work in the following applications:

TRPC7

GT41031 100 ug
EUR 474

TRPC7 Conjugated Antibody

C35976 100ul
EUR 397

Anti-TRPC7 antibody

STJ71876 100 µg
EUR 359

Anti-TRPC7 antibody

STJ119779 100 µl
EUR 277

Anti-TRPC7 antibody

STJ191416 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TRPC7

TRPC7 siRNA

20-abx938221
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TRPC7 siRNA

20-abx938222
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Monoclonal antibody for TrpC7

SMC-343D 0.1mg
EUR 353
  • Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
  • Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is not conjugated.

Monoclonal antibody for TrpC7

SMC-343D-A390 0.1mg
EUR 400
  • Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
  • Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with ATTO 390.

Monoclonal antibody for TrpC7

SMC-343D-A488 0.1mg
EUR 399
  • Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
  • Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with ATTO 488.

Monoclonal antibody for TrpC7

SMC-343D-A565 0.1mg
EUR 399
  • Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
  • Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with ATTO 565.

Monoclonal antibody for TrpC7

SMC-343D-A594 0.1mg
EUR 399
  • Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
  • Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with ATTO 594.

Monoclonal antibody for TrpC7

SMC-343D-A633 0.1mg
EUR 399
  • Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
  • Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with ATTO 633.

Monoclonal antibody for TrpC7

SMC-343D-A655 0.1mg
EUR 399
  • Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
  • Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with ATTO 655.

Monoclonal antibody for TrpC7

SMC-343D-A680 0.1mg
EUR 399
  • Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
  • Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with ATTO 680.

Monoclonal antibody for TrpC7

SMC-343D-A700 0.1mg
EUR 399
  • Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
  • Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with ATTO 700.

Monoclonal antibody for TrpC7

SMC-343D-ALP 0.1mg
EUR 393
  • Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
  • Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with Alkaline Phosphatase.

Monoclonal antibody for TrpC7

SMC-343D-APC 0.1mg
EUR 398
  • Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
  • Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with APC.

Monoclonal antibody for TrpC7

SMC-343D-APCCY7 0.1mg
EUR 470
  • Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
  • Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with APC/Cy7.

Monoclonal antibody for TrpC7

SMC-343D-BI 0.1mg
EUR 395
  • Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
  • Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with Biotin.

Monoclonal antibody for TrpC7

SMC-343D-DY350 0.1mg
EUR 413
  • Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
  • Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with Dylight 350.

Monoclonal antibody for TrpC7

SMC-343D-DY405 0.1mg
EUR 402
  • Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
  • Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with Dylight 405.

Monoclonal antibody for TrpC7

SMC-343D-DY488 0.1mg
EUR 392
  • Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
  • Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with Dylight 488.

Monoclonal antibody for TrpC7

SMC-343D-DY594 0.1mg
EUR 394
  • Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
  • Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with Dylight 594.

Monoclonal antibody for TrpC7

SMC-343D-DY633 0.1mg
EUR 389
  • Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
  • Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with Dylight 633.

Monoclonal antibody for TrpC7

SMC-343D-FITC 0.1mg
EUR 391
  • Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
  • Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with FITC.

Monoclonal antibody for TrpC7

SMC-343D-HRP 0.1mg
EUR 387
  • Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
  • Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with HRP.

Monoclonal antibody for TrpC7

SMC-343D-P594 0.1mg
EUR 406
  • Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
  • Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with PE/ATTO 594.

Monoclonal antibody for TrpC7

SMC-343D-PCP 0.1mg
EUR 398
  • Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
  • Show more
Description: A monoclonal antibody from clone S64A-36 against Human TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with PerCP.

Monoclonal antibody for TrpC7

SMC-343D-RPE 0.1mg
EUR 396
  • Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
  • Show more
Description: A monoclonal antibody from clone S64A-36 against Human TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with RPE.

Monoclonal antibody for TrpC7

SMC-343D-STR 0.1mg
EUR 397
  • Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
  • Show more
Description: A monoclonal antibody from clone S64A-36 against Human TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with Streptavidin.

Monoclonal antibody for TrpC7

SMC-343S 0.012mg
EUR 65
  • Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
  • Show more
Description: A monoclonal antibody from clone S64A-36 against Human TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is not conjugated.

TRPC7 cloning plasmid

CSB-CL888031HU-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2589
  • Sequence: ATGTTGAGGAACAGCACCTTCAAAAACATGCAGCGCCGGCACACAACGCTGAGGGAGAAGGGCCGTCGCCAGGCCATCCGGGGTCCCGCCTACATGTTCAACGAGAAGGGCACCAGTCTGACGCCCGAGGAGGAGCGCTTCCTGGACTCGGCTGAGTATGGCAACATCCCGGTGG
  • Show more
Description: A cloning plasmid for the TRPC7 gene.

Anti-TRP 7/TRPC7 Antibody

PB9272 100ug/vial
EUR 294

TRPC7 Rabbit Polyclonal Antibody