SYT9 Rabbit Polyclonal Antibody
To Order Contact us: [email protected]
 SYT9 Polyclonal Antibody |
|
ES10339-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against SYT9 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 SYT9 antibody |
|
70R-20680 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal SYT9 antibody |
 SYT9 Antibody |
|
35939-100ul |
SAB |
100ul |
EUR 252 |
SYT9 Antibody |
|
1-CSB-PA272409 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against SYT9. Recognizes SYT9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000 |
SYT9 antibody |
|
70R-7051 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal SYT9 antibody raised against the middle region of SYT9 |
SYT9 Antibody |
|
1-CSB-PA023045GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against SYT9. Recognizes SYT9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
 SYT9 Conjugated Antibody |
|
C35939 |
SAB |
100ul |
EUR 397 |
 Anti-SYT9 antibody |
|
STJ191497 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to SYT9 |
 SYT9 siRNA |
|
20-abx905420 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SYT9 siRNA |
|
20-abx935869 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SYT9 siRNA |
|
20-abx935870 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Antibody) Synaptotagmin 9 (SYT9) Antibody |
|
20-abx214322 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Antibody) Synaptotagmin Ix (SYT9) Antibody |
|
20-abx115952 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Synaptotagmin 9 (SYT9) Antibody |
|
abx146114-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
 Antibody) Synaptotagmin-9 (Syt9) Antibody |
|
abx432049-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Synaptotagmin-9 (Syt9) Antibody |
|
abx445047-100ug |
Abbexa |
100 ug |
EUR 523 |
- Shipped within 5-12 working days.
|
 SYT9 Blocking Peptide |
|
33R-7008 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SYT9 antibody, catalog no. 70R-7051 |
 SYT9 cloning plasmid |
|
CSB-CL803111HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 960
- Sequence: atgctggcgaaggtggtggagggagatttagctttcaaaggaggcagagatatctcagtgagcctgctgacccttgtggtcactgcctgtggtctcgctctctttggcgtgtctctcttcgtatcttggaaactctgctgggttccgtggcgagaacgaggcctgccctctggtag
- Show more
|
|
Description: A cloning plasmid for the SYT9 gene. |
SYT9 cloning plasmid |
|
CSB-CL803111HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1476
- Sequence: atgcccggggccagggacgcgctctgtcaccaggcgctgcagctgctggccgagctctgtgcccgtggggccctggagcacgacagctgccaggatttcatttaccacctgcgggaccgtgccagaccccggctccgcgacccagatatctcagtgagcctgctgacccttgtgg
- Show more
|
|
Description: A cloning plasmid for the SYT9 gene. |
 Antibody (ALP)) Synaptotagmin-9 (Syt9) Antibody (ALP) |
|
abx442444-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
 Antibody (APC)) Synaptotagmin-9 (Syt9) Antibody (APC) |
|
abx442725-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
 Antibody (Biotin)) Synaptotagmin-9 (Syt9) Antibody (Biotin) |
|
abx443005-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
 Antibody (FITC)) Synaptotagmin-9 (Syt9) Antibody (FITC) |
|
abx443285-100ug |
Abbexa |
100 ug |
EUR 565 |
- Shipped within 5-12 working days.
|
 Antibody (HRP)) Synaptotagmin-9 (Syt9) Antibody (HRP) |
|
abx443566-100ug |
Abbexa |
100 ug |
EUR 565 |
- Shipped within 5-12 working days.
|
 Antibody (PerCP)) Synaptotagmin-9 (Syt9) Antibody (PerCP) |
|
abx444128-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
 Antibody (RPE)) Synaptotagmin-9 (Syt9) Antibody (RPE) |
|
abx444409-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
 Antibody (Streptavidin)) Synaptotagmin-9 (Syt9) Antibody (Streptavidin) |
|
abx444690-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
 Mouse SYT9 shRNA Plasmid |
|
20-abx975214 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human SYT9 shRNA Plasmid |
|
20-abx965370 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Rat SYT9 shRNA Plasmid |
|
20-abx986065 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) SYT9 Recombinant Protein (Rat) |
|
RP232004 |
ABM |
100 ug |
Ask for price |
) SYT9 Recombinant Protein (Human) |
|
RP030793 |
ABM |
100 ug |
Ask for price |
SYT9 Recombinant Protein (Human) |
|
RP030796 |
ABM |
100 ug |
Ask for price |
) SYT9 Recombinant Protein (Mouse) |
|
RP176909 |
ABM |
100 ug |
Ask for price |
 Antibody (ATTO 390)) Synaptotagmin-9 (Syt9) Antibody (ATTO 390) |
|
abx440196-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
 Antibody (ATTO 488)) Synaptotagmin-9 (Syt9) Antibody (ATTO 488) |
|
abx440477-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
 Antibody (ATTO 565)) Synaptotagmin-9 (Syt9) Antibody (ATTO 565) |
|
abx440758-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
 Antibody (ATTO 594)) Synaptotagmin-9 (Syt9) Antibody (ATTO 594) |
|
abx441039-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
 Antibody (ATTO 633)) Synaptotagmin-9 (Syt9) Antibody (ATTO 633) |
|
abx441320-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
 Antibody (ATTO 655)) Synaptotagmin-9 (Syt9) Antibody (ATTO 655) |
|
abx441601-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
 Antibody (ATTO 680)) Synaptotagmin-9 (Syt9) Antibody (ATTO 680) |
|
abx441882-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
 Antibody (ATTO 700)) Synaptotagmin-9 (Syt9) Antibody (ATTO 700) |
|
abx442163-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
 Antibody (PE/ATTO 594)) Synaptotagmin-9 (Syt9) Antibody (PE/ATTO 594) |
|
abx443847-100ug |
Abbexa |
100 ug |
EUR 592 |
- Shipped within 5-12 working days.
|
 (pORF)) Syt9 ORF Vector (Rat) (pORF) |
|
ORF077336 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) SYT9 ORF Vector (Human) (pORF) |
|
ORF010265 |
ABM |
1.0 ug DNA |
EUR 95 |
SYT9 ORF Vector (Human) (pORF) |
|
ORF010266 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Syt9 ORF Vector (Mouse) (pORF) |
|
ORF058971 |
ABM |
1.0 ug DNA |
EUR 506 |
 ELISA Kit) Human Synaptotagmin 9 (SYT9) ELISA Kit |
|
abx383594-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
) Syt9 sgRNA CRISPR Lentivector set (Rat) |
|
K6855101 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Syt9 sgRNA CRISPR Lentivector set (Mouse) |
|
K3813101 |
ABM |
3 x 1.0 ug |
EUR 339 |
) SYT9 sgRNA CRISPR Lentivector set (Human) |
|
K2323301 |
ABM |
3 x 1.0 ug |
EUR 339 |
) ELISA kit for Rat Synaptotagmin-9 (SYT9) |
|
KTE100165-48T |
Abbkine |
48T |
EUR 332 |
- member of a family of membrane proteins characterized by one transmembrane region and two C2 domains [RGD, Feb 2006]
|
|
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-9 (SYT9) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Synaptotagmin-9 (SYT9) |
|
KTE100165-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- member of a family of membrane proteins characterized by one transmembrane region and two C2 domains [RGD, Feb 2006]
|
|
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-9 (SYT9) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Synaptotagmin-9 (SYT9) |
|
KTE100165-96T |
Abbkine |
96T |
EUR 539 |
- member of a family of membrane proteins characterized by one transmembrane region and two C2 domains [RGD, Feb 2006]
|
|
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-9 (SYT9) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
 (Target 1)) Syt9 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6855102 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Syt9 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6855103 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Syt9 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6855104 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Syt9 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3813102 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Syt9 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3813103 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Syt9 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3813104 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) SYT9 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K2323302 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) SYT9 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K2323303 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) SYT9 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K2323304 |
ABM |
1.0 ug DNA |
EUR 154 |
) ELISA kit for Human Synaptotagmin-9 (SYT9) |
|
KTE60440-48T |
Abbkine |
48T |
EUR 332 |
- Synaptotagmin-9 (SYT9) may be involved in Ca2+-dependent exocytosis of secretory vesicles through Ca2+ and phospholipid binding to the C2 domain or may serve as Ca2+ sensors in the process of vesicular trafficking and exocytosis.
|
|
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-9 (SYT9) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Synaptotagmin-9 (SYT9) |
|
KTE60440-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Synaptotagmin-9 (SYT9) may be involved in Ca2+-dependent exocytosis of secretory vesicles through Ca2+ and phospholipid binding to the C2 domain or may serve as Ca2+ sensors in the process of vesicular trafficking and exocytosis.
|
|
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-9 (SYT9) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Synaptotagmin-9 (SYT9) |
|
KTE60440-96T |
Abbkine |
96T |
EUR 539 |
- Synaptotagmin-9 (SYT9) may be involved in Ca2+-dependent exocytosis of secretory vesicles through Ca2+ and phospholipid binding to the C2 domain or may serve as Ca2+ sensors in the process of vesicular trafficking and exocytosis.
|
|
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-9 (SYT9) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
) ELISA kit for Mouse Synaptotagmin-9 (SYT9) |
|
KTE70310-48T |
Abbkine |
48T |
EUR 332 |
- SYT9 (Synaptotagmin 9) is a Protein Coding gene. Among its related pathways are Protein-protein interactions at synapses and Vesicle-mediated transport. GO annotations related to SYT9 include calcium ion binding and transporter activity. An important
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-9 (SYT9) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Synaptotagmin-9 (SYT9) |
|
KTE70310-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- SYT9 (Synaptotagmin 9) is a Protein Coding gene. Among its related pathways are Protein-protein interactions at synapses and Vesicle-mediated transport. GO annotations related to SYT9 include calcium ion binding and transporter activity. An important
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-9 (SYT9) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Synaptotagmin-9 (SYT9) |
|
KTE70310-96T |
Abbkine |
96T |
EUR 539 |
- SYT9 (Synaptotagmin 9) is a Protein Coding gene. Among its related pathways are Protein-protein interactions at synapses and Vesicle-mediated transport. GO annotations related to SYT9 include calcium ion binding and transporter activity. An important
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-9 (SYT9) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
 (pPB-C-His)) SYT9 Protein Vector (Rat) (pPB-C-His) |
|
PV309342 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) SYT9 Protein Vector (Rat) (pPB-N-His) |
|
PV309343 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) SYT9 Protein Vector (Rat) (pPM-C-HA) |
|
PV309344 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) SYT9 Protein Vector (Rat) (pPM-C-His) |
|
PV309345 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) SYT9 Protein Vector (Human) (pPB-C-His) |
|
PV041057 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) SYT9 Protein Vector (Human) (pPB-N-His) |
|
PV041058 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) SYT9 Protein Vector (Human) (pPM-C-HA) |
|
PV041059 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) SYT9 Protein Vector (Human) (pPM-C-His) |
|
PV041060 |
ABM |
500 ng |
EUR 329 |
SYT9 Protein Vector (Human) (pPB-C-His) |
|
PV041061 |
ABM |
500 ng |
EUR 329 |
SYT9 Protein Vector (Human) (pPB-N-His) |
|
PV041062 |
ABM |
500 ng |
EUR 329 |
SYT9 Protein Vector (Human) (pPM-C-HA) |
|
PV041063 |
ABM |
500 ng |
EUR 329 |
SYT9 Protein Vector (Human) (pPM-C-His) |
|
PV041064 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) SYT9 Protein Vector (Mouse) (pPB-C-His) |
|
PV235882 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) SYT9 Protein Vector (Mouse) (pPB-N-His) |
|
PV235883 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) SYT9 Protein Vector (Mouse) (pPM-C-HA) |
|
PV235884 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) SYT9 Protein Vector (Mouse) (pPM-C-His) |
|
PV235885 |
ABM |
500 ng |
EUR 603 |
 Syt9 3'UTR Luciferase Stable Cell Line |
|
TU120050 |
ABM |
1.0 ml |
Ask for price |
 Syt9 3'UTR GFP Stable Cell Line |
|
TU170050 |
ABM |
1.0 ml |
Ask for price |
Syt9 3'UTR Luciferase Stable Cell Line |
|
TU221496 |
ABM |
1.0 ml |
Ask for price |
 SYT9 3'UTR GFP Stable Cell Line |
|
TU075029 |
ABM |
1.0 ml |
EUR 1521 |
Syt9 3'UTR GFP Stable Cell Line |
|
TU271496 |
ABM |
1.0 ml |
Ask for price |
 SYT9 3'UTR Luciferase Stable Cell Line |
|
TU025029 |
ABM |
1.0 ml |
EUR 1521 |
 (CMV) (pLenti-GIII-CMV)) SYT9 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
|
LV715617 |
ABM |
1.0 ug DNA |
EUR 316 |
 (UbC) (pLenti-GIII-UbC)) SYT9 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
|
LV715621 |
ABM |
1.0 ug DNA |
EUR 316 |
 (EF1a) (pLenti-GIII-EF1a)) SYT9 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
|
LV715622 |
ABM |
1.0 ug DNA |
EUR 316 |
 (CMV) (pLenti-GIII-CMV)) SYT9 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV692905 |
ABM |
1.0 ug DNA |
EUR 682 |
 (UbC) (pLenti-GIII-UbC)) SYT9 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV692909 |
ABM |
1.0 ug DNA |
EUR 682 |
 (EF1a) (pLenti-GIII-EF1a)) SYT9 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV692910 |
ABM |
1.0 ug DNA |
EUR 682 |
 GAPDH Rabbit Polyclonal Antibody |
|
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
|
37985-50ul |
SAB |
50ul |
EUR 187 |
 EFHD1 Rabbit Polyclonal Antibody |
|
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
|
38001-50ul |
SAB |
50ul |
EUR 187 |
 Alliinase Rabbit Polyclonal Antibody |
|
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
|
38042-50ul |
SAB |
50ul |
EUR 187 |
 ECFP Rabbit Polyclonal Antibody |
|
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
|
38077-50ul |
SAB |
50ul |
EUR 187 |
 EYFP Rabbit Polyclonal Antibody |
|
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
|
38078-50ul |
SAB |
50ul |
EUR 187 |
 mOrange Rabbit Polyclonal Antibody |
|
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
|
38079-50ul |
SAB |
50ul |
EUR 187 |
 mStrawberry Rabbit Polyclonal Antibody |
|
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
|
38083-50ul |
SAB |
50ul |
EUR 187 |
 AmCyan Rabbit Polyclonal Antibody |
|
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
|
38086-50ul |
SAB |
50ul |
EUR 187 |
 EBFP Rabbit Polyclonal Antibody |
|
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
|
38087-50ul |
SAB |
50ul |
EUR 187 |
 Vimentin Rabbit Polyclonal Antibody |
|
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
|
38104-50ul |
SAB |
50ul |
EUR 187 |
 LDHD Rabbit Polyclonal Antibody |
|
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
|
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
SYT9 Rabbit Polyclonal Antibody
