January 17, 2022

SF3A1 Rabbit Polyclonal Antibody

SF3A1 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

SF3A1 Polyclonal Antibody

ABP60372-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human SF3A1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SF3A1 from Human, Mouse. This SF3A1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SF3A1 protein

SF3A1 Polyclonal Antibody

ES10305-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against SF3A1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

SF3A1 Polyclonal Antibody

ES10305-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SF3A1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

SF3A1 Rabbit pAb

A4399-100ul 100 ul
EUR 308

SF3A1 Rabbit pAb

A4399-200ul 200 ul
EUR 459

SF3A1 Rabbit pAb

A4399-20ul 20 ul
EUR 183

SF3A1 Rabbit pAb

A4399-50ul 50 ul
EUR 223

SF3A1 Polyclonal Conjugated Antibody

C30560 100ul
EUR 397

SF3A1 antibody

70R-20192 50 ul
EUR 435
Description: Rabbit polyclonal SF3A1 antibody

SF3A1 antibody

70R-4828 50 ug
EUR 467
Description: Rabbit polyclonal SF3A1 antibody raised against the N terminal of SF3A1

SF3A1 antibody

70R-5001 50 ug
EUR 467
Description: Rabbit polyclonal SF3A1 antibody raised against the N terminal of SF3A1

SF3A1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SF3A1. Recognizes SF3A1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

anti- SF3A1 antibody

FNab07774 100µg
EUR 548.75
  • Immunogen: splicing factor 3a, subunit 1, 120kDa
  • Uniprot ID: Q15459
  • Gene ID: 10291
  • Research Area: Neuroscience, Metabolism, Epigenetics
Description: Antibody raised against SF3A1

Anti-SF3A1 antibody

PAab07774 100 ug
EUR 386

Anti-SF3A1 antibody

STJ11100905 100 µl
EUR 277
Description: This gene encodes a subunit of the splicing factor 3a protein complex. The splicing factor 3a heterotrimer is a component of the mature U2 small nuclear ribonucleoprotein particle (snRNP). U2 small nuclear ribonucleoproteins play a critical role in spliceosome assembly and pre-mRNA splicing.

Anti-SF3A1 antibody

STJ191463 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SF3A1


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA25535 50 ul
EUR 334
Description: Mouse polyclonal to SF3A1

SF3A1 Blocking Peptide

33R-8124 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SF3A1 antibody, catalog no. 70R-4828

SF3A1 Blocking Peptide

33R-7702 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SF3A1 antibody, catalog no. 70R-5001

SF3A1 cloning plasmid

CSB-CL613594HU-10ug 10ug
EUR 776
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2382
  • Sequence: atgccggccggacccgtgcaggcggtgcccccgccgccgcccgtgcccacggagcccaaacagcccacagaagaagaagcatcttcaaaggaggattctgcaccttctaagccagttgtggggattatttaccctcctccagaggtcagaaatattgttgacaagactgccagct
  • Show more
Description: A cloning plasmid for the SF3A1 gene.


EF002850 96 Tests
EUR 689

Mouse SF3A1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SF3A1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SF3A1 Recombinant Protein (Human)

RP028270 100 ug Ask for price

SF3A1 Recombinant Protein (Rat)

RP228347 100 ug Ask for price

SF3A1 Recombinant Protein (Mouse)

RP171314 100 ug Ask for price

Splicing Factor 3A Subunit 1 (SF3A1) Antibody

abx237774-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Sf3a1 ORF Vector (Rat) (pORF)

ORF076117 1.0 ug DNA
EUR 506

SF3A1 ORF Vector (Human) (pORF)

ORF009424 1.0 ug DNA
EUR 95

Sf3a1 ORF Vector (Mouse) (pORF)

ORF057106 1.0 ug DNA
EUR 506

Sf3a1 sgRNA CRISPR Lentivector set (Rat)

K6401101 3 x 1.0 ug
EUR 339

Sf3a1 sgRNA CRISPR Lentivector set (Mouse)

K3428301 3 x 1.0 ug
EUR 339

SF3A1 sgRNA CRISPR Lentivector set (Human)

K2129901 3 x 1.0 ug
EUR 339

Splicing Factor 3A, Subunit 1, 120 kDa (SF3A1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sf3a1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6401102 1.0 ug DNA
EUR 154

Sf3a1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6401103 1.0 ug DNA
EUR 154

Sf3a1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6401104 1.0 ug DNA
EUR 154

Sf3a1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3428302 1.0 ug DNA
EUR 154

Sf3a1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3428303 1.0 ug DNA
EUR 154

Sf3a1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3428304 1.0 ug DNA
EUR 154

SF3A1 sgRNA CRISPR Lentivector (Human) (Target 1)

K2129902 1.0 ug DNA
EUR 154

SF3A1 sgRNA CRISPR Lentivector (Human) (Target 2)

K2129903 1.0 ug DNA
EUR 154

SF3A1 sgRNA CRISPR Lentivector (Human) (Target 3)

K2129904 1.0 ug DNA
EUR 154

SF3A1 Protein Vector (Rat) (pPB-C-His)

PV304466 500 ng
EUR 1191

SF3A1 Protein Vector (Rat) (pPB-N-His)

PV304467 500 ng
EUR 1191

SF3A1 Protein Vector (Rat) (pPM-C-HA)

PV304468 500 ng
EUR 1191

SF3A1 Protein Vector (Rat) (pPM-C-His)

PV304469 500 ng
EUR 1191

SF3A1 Protein Vector (Human) (pPB-C-His)

PV037693 500 ng
EUR 329

SF3A1 Protein Vector (Human) (pPB-N-His)

PV037694 500 ng
EUR 329

SF3A1 Protein Vector (Human) (pPM-C-HA)

PV037695 500 ng
EUR 329

SF3A1 Protein Vector (Human) (pPM-C-His)

PV037696 500 ng
EUR 329

SF3A1 Protein Vector (Mouse) (pPB-C-His)

PV228422 500 ng
EUR 1065

SF3A1 Protein Vector (Mouse) (pPB-N-His)

PV228423 500 ng
EUR 1065

SF3A1 Protein Vector (Mouse) (pPM-C-HA)

PV228424 500 ng
EUR 1065

SF3A1 Protein Vector (Mouse) (pPM-C-His)

PV228425 500 ng
EUR 1065

Sf3a1 3'UTR Luciferase Stable Cell Line

TU118677 1.0 ml Ask for price

Sf3a1 3'UTR GFP Stable Cell Line

TU168677 1.0 ml Ask for price

Sf3a1 3'UTR Luciferase Stable Cell Line

TU220221 1.0 ml Ask for price

Sf3a1 3'UTR GFP Stable Cell Line

TU270221 1.0 ml Ask for price

SF3A1 3'UTR GFP Stable Cell Line

TU073012 1.0 ml
EUR 1521

SF3A1 3'UTR Luciferase Stable Cell Line

TU023012 1.0 ml
EUR 1521

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

SF3A1 Rabbit Polyclonal Antibody