October 23, 2021

HCN3 Rabbit Polyclonal Antibody

HCN3 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

HCN3 Polyclonal Antibody

ABP58761-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human HCN3 protein at amino acid sequence of 150-230
  • Applications tips:
Description: A polyclonal antibody for detection of HCN3 from Human, Mouse, Rat. This HCN3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HCN3 protein at amino acid sequence of 150-230

HCN3 Polyclonal Antibody

ABP58761-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human HCN3 protein at amino acid sequence of 150-230
  • Applications tips:
Description: A polyclonal antibody for detection of HCN3 from Human, Mouse, Rat. This HCN3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HCN3 protein at amino acid sequence of 150-230

HCN3 Polyclonal Antibody

ES10036-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HCN3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

HCN3 Polyclonal Antibody

ES10036-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HCN3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Polyclonal HCN3 (extracellular) Antibody

APR12352G 0.05ml
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HCN3 (extracellular) . This antibody is tested and proven to work in the following applications:

HCN3 antibody

70R-17702 50 ul
EUR 435
Description: Rabbit polyclonal HCN3 antibody

HCN3 Antibody

43682-100ul 100ul
EUR 252

HCN3 Antibody

DF9770 200ul
EUR 304
Description: HCN3 Antibody detects endogenous levels of total HCN3.

HCN3 antibody

70R-5168 50 ug
EUR 467
Description: Rabbit polyclonal HCN3 antibody raised against the middle region of HCN3

HCN3 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against HCN3. Recognizes HCN3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

HCN3 Antibody

ABD13116 100 ug
EUR 438

HCN3 Antibody

ABD9770 100 ug
EUR 438

Polyclonal HCN3 Antibody (internal region)

APR12330G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human HCN3 (internal region). This antibody is tested and proven to work in the following applications:

Polyclonal HCN3 antibody - middle region

APR12331G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HCN3 - middle region. This antibody is tested and proven to work in the following applications:

HCN3 Conjugated Antibody

C43682 100ul
EUR 397

anti- HCN3 antibody

FNab03789 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:5000
  • Immunogen: hyperpolarization activated cyclic nucleotide-gated potassium channel 3
  • Uniprot ID: Q9P1Z3
  • Gene ID: 57657
  • Research Area: Cardiovascular
Description: Antibody raised against HCN3

Anti-HCN3 antibody

PAab03789 100 ug
EUR 386

Anti-HCN3 antibody

STJ72294 100 µg
EUR 359

Anti-HCN3 antibody

STJ191194 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to HCN3

Hcn3/ Rat Hcn3 ELISA Kit

ELI-31647r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Monoclonal antibody for HCN3

SMC-306D 0.1mg
EUR 353
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is not conjugated.

Monoclonal antibody for HCN3

SMC-306D-A390 0.1mg
EUR 400
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with ATTO 390.

Monoclonal antibody for HCN3

SMC-306D-A488 0.1mg
EUR 399
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with ATTO 488.

Monoclonal antibody for HCN3

SMC-306D-A565 0.1mg
EUR 399
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with ATTO 565.

Monoclonal antibody for HCN3

SMC-306D-A594 0.1mg
EUR 399
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with ATTO 594.

Monoclonal antibody for HCN3

SMC-306D-A633 0.1mg
EUR 399
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with ATTO 633.

Monoclonal antibody for HCN3

SMC-306D-A655 0.1mg
EUR 399
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with ATTO 655.

Monoclonal antibody for HCN3

SMC-306D-A680 0.1mg
EUR 399
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with ATTO 680.

Monoclonal antibody for HCN3

SMC-306D-A700 0.1mg
EUR 399
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with ATTO 700.

Monoclonal antibody for HCN3

SMC-306D-ALP 0.1mg
EUR 393
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with Alkaline Phosphatase.

Monoclonal antibody for HCN3

SMC-306D-APC 0.1mg
EUR 398
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with APC.

Monoclonal antibody for HCN3

SMC-306D-APCCY7 0.1mg
EUR 470
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with APC/Cy7.

Monoclonal antibody for HCN3

SMC-306D-BI 0.1mg
EUR 395
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with Biotin.

Monoclonal antibody for HCN3

SMC-306D-DY350 0.1mg
EUR 413
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with Dylight 350.

Monoclonal antibody for HCN3

SMC-306D-DY405 0.1mg
EUR 402
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with Dylight 405.

Monoclonal antibody for HCN3

SMC-306D-DY488 0.1mg
EUR 392
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with Dylight 488.

Monoclonal antibody for HCN3

SMC-306D-DY594 0.1mg
EUR 394
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with Dylight 594.

Monoclonal antibody for HCN3

SMC-306D-DY633 0.1mg
EUR 389
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with Dylight 633.

Monoclonal antibody for HCN3

SMC-306D-FITC 0.1mg
EUR 391
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with FITC.

Monoclonal antibody for HCN3

SMC-306D-HRP 0.1mg
EUR 387
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with HRP.

Monoclonal antibody for HCN3

SMC-306D-P594 0.1mg
EUR 406
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with PE/ATTO 594.

Monoclonal antibody for HCN3

SMC-306D-PCP 0.1mg
EUR 398
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Rat HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with PerCP.

Monoclonal antibody for HCN3

SMC-306D-RPE 0.1mg
EUR 396
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Rat HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with RPE.

Monoclonal antibody for HCN3

SMC-306D-STR 0.1mg
EUR 397
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Rat HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with Streptavidin.

Monoclonal antibody for HCN3

SMC-306S 0.012mg
EUR 65
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Rat HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is not conjugated.

Polyclonal HCN3 (aa 715-728) Antibody (internal region)

APR12351G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human HCN3 (aa 715-728) (internal region). This antibody is tested and proven to work in the following applications:

HCN3 Blocking Peptide

33R-5296 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HCN3 antibody, catalog no. 70R-5168

HCN3 Blocking Peptide

DF9770-BP 1mg
EUR 195

HCN3 cloning plasmid

CSB-CL868385HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1341
  • Sequence: atgctcagcatgatcgtaggtgccacatgctacgccatgttcatcggccatgccacggcactcatccagtccctggactcttcccggcgtcagtaccaggagaagtacaagcaggtggagcagtacatgtccttccacaagctgccagcagacacgcggcagcgcatccacgagt
  • Show more
Description: A cloning plasmid for the HCN3 gene.

Anti-HCN3 (aa 715-728) antibody

STJ72293 100 µg
EUR 359


ELI-31591h 96 Tests
EUR 824


EF010077 96 Tests
EUR 689

Rat HCN3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human HCN3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse HCN3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Hcn3 ELISA KIT

ELI-38902m 96 Tests
EUR 865

pCMV-SPORT6-HCN3 Plasmid

PVT16573 2 ug
EUR 325

HCN3 Recombinant Protein (Human)

RP014485 100 ug Ask for price

HCN3 Recombinant Protein (Rat)

RP204308 100 ug Ask for price

HCN3 Recombinant Protein (Mouse)

RP141071 100 ug Ask for price

Hcn3 ORF Vector (Rat) (pORF)

ORF068104 1.0 ug DNA
EUR 506

HCN3 ORF Vector (Human) (pORF)

ORF004829 1.0 ug DNA
EUR 95

Hcn3 ORF Vector (Mouse) (pORF)

ORF047025 1.0 ug DNA
EUR 506

Hcn3 sgRNA CRISPR Lentivector set (Mouse)

K5030201 3 x 1.0 ug
EUR 339

Hcn3 sgRNA CRISPR Lentivector set (Rat)

K7115901 3 x 1.0 ug
EUR 339

HCN3 sgRNA CRISPR Lentivector set (Human)

K0938301 3 x 1.0 ug
EUR 339

Rabbit Anti-Mouse Hyperpolarization-activated Cyclic Nucleotide-gated channel 3 (HCN3) antiserum

HCN31-S 100 ul
EUR 457

Hcn3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K5030202 1.0 ug DNA
EUR 154

Hcn3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K5030203 1.0 ug DNA
EUR 154

Hcn3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K5030204 1.0 ug DNA
EUR 154

Hcn3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7115902 1.0 ug DNA
EUR 154

Hcn3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7115903 1.0 ug DNA
EUR 154

Hcn3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7115904 1.0 ug DNA
EUR 154

HCN3 sgRNA CRISPR Lentivector (Human) (Target 1)

K0938302 1.0 ug DNA
EUR 154

HCN3 sgRNA CRISPR Lentivector (Human) (Target 2)

K0938303 1.0 ug DNA
EUR 154

HCN3 sgRNA CRISPR Lentivector (Human) (Target 3)

K0938304 1.0 ug DNA
EUR 154

HCN3 Protein Vector (Rat) (pPB-C-His)

PV272414 500 ng
EUR 1166

HCN3 Protein Vector (Rat) (pPB-N-His)

PV272415 500 ng
EUR 1166

HCN3 Protein Vector (Rat) (pPM-C-HA)

PV272416 500 ng
EUR 1166

HCN3 Protein Vector (Rat) (pPM-C-His)

PV272417 500 ng
EUR 1166

HCN3 Protein Vector (Mouse) (pPB-C-His)

PV188098 500 ng
EUR 1065

HCN3 Protein Vector (Mouse) (pPB-N-His)

PV188099 500 ng
EUR 1065

HCN3 Protein Vector (Mouse) (pPM-C-HA)

PV188100 500 ng
EUR 1065

HCN3 Protein Vector (Mouse) (pPM-C-His)

PV188101 500 ng
EUR 1065

HCN3 Protein Vector (Human) (pPB-C-His)

PV019313 500 ng
EUR 329

HCN3 Protein Vector (Human) (pPB-N-His)

PV019314 500 ng
EUR 329

HCN3 Protein Vector (Human) (pPM-C-HA)

PV019315 500 ng
EUR 329

HCN3 Protein Vector (Human) (pPM-C-His)

PV019316 500 ng
EUR 329

Hcn3 3'UTR Luciferase Stable Cell Line

TU109397 1.0 ml Ask for price

Hcn3 3'UTR Luciferase Stable Cell Line

TU205674 1.0 ml Ask for price

Hcn3 3'UTR GFP Stable Cell Line

TU159397 1.0 ml Ask for price

Hcn3 3'UTR GFP Stable Cell Line

TU255674 1.0 ml Ask for price

HCN3 3'UTR GFP Stable Cell Line

TU059641 1.0 ml
EUR 1394

HCN3 3'UTR Luciferase Stable Cell Line

TU009641 1.0 ml
EUR 1394

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody

ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody

ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

JAK1 Rabbit Polyclonal Antibody

ABP57569-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody

ABP57569-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody

ABP57569-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK2 Rabbit Polyclonal Antibody

ABP57570-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody

ABP57570-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody

ABP57570-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK3 Rabbit Polyclonal Antibody

ABP57572-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody

ABP57572-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody

ABP57572-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

MEK2 Rabbit Polyclonal Antibody

ABP57573-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody

ABP57573-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody

ABP57573-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK3 Rabbit Polyclonal Antibody

ABP57574-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

HCN3 Rabbit Polyclonal Antibody