January 17, 2022

STK40 Rabbit Polyclonal Antibody

STK40 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

STK40 Polyclonal Antibody

ES10205-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against STK40 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

STK40 antibody

70R-13420 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal STK40 antibody

STK40 Antibody

36201-100ul 100ul
EUR 252

STK40 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against STK40. Recognizes STK40 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200

STK40 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against STK40. Recognizes STK40 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

Polyclonal STK40 Antibody ( C-term )

APR06136G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STK40 ( C-term ). This antibody is tested and proven to work in the following applications:

STK40 Conjugated Antibody

C36201 100ul
EUR 397

Anti-STK40 antibody

STJ191363 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to STK40

Stk40/ Rat Stk40 ELISA Kit

ELI-41340r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA21285 50 ug
EUR 363
Description: Mouse polyclonal to STK40


YF-PA21286 100 ul
EUR 403
Description: Rabbit polyclonal to STK40


YF-PA26700 50 ul
EUR 334
Description: Mouse polyclonal to STK40

STK40 cloning plasmid

CSB-CL854027HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 702
  • Sequence: atggtgctcaacaagaggacacatcggataaccatcaccaacttctgcctcgggaagcatctggtgagcgagggggacctgctgaaggaccagagagggagccctgcctacatcagtcccgacgtgctcagcggccggccgtaccgtggcaagcccagtgacatgtgggccctggg
  • Show more
Description: A cloning plasmid for the STK40 gene.

STK40 cloning plasmid

CSB-CL854027HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1308
  • Sequence: atgaagcggagagcatcagacagaggagctggggaaacgtcggccagggccaaggctctaggaagtgggatttctggaaataatgcaaagagagctggaccattcatccttggtccccgtctgggcaactcaccggtgccaagcatagtgcagtgtttggcgaggaaagatggca
  • Show more
Description: A cloning plasmid for the STK40 gene.

pDONR223-STK40 Plasmid

PVTB00842 2 ug
EUR 356

Anti-STK40 (4G3)

YF-MA11688 100 ug
EUR 363
Description: Mouse monoclonal to STK40

Serine/threonine Kinase 40 (STK40) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serine/threonine Kinase 40 (STK40) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serine/threonine Kinase 40 (STK40) Antibody

abx145680-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Serine/threonine Kinase 40 (STK40) Antibody

abx034199-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Serine/threonine Kinase 40 (STK40) Antibody

abx034199-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Rat STK40 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse STK40 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human STK40 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

STK40 Recombinant Protein (Rat)

RP231494 100 ug Ask for price

STK40 Recombinant Protein (Human)

RP030442 100 ug Ask for price

STK40 Recombinant Protein (Human)

RP030445 100 ug Ask for price

STK40 Recombinant Protein (Mouse)

RP176108 100 ug Ask for price

STK40 Recombinant Protein (Mouse)

RP176111 100 ug Ask for price

Rabbit Serine/threonine protein kinase 40(STK40) ELISA kit

E04S0412-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Serine/threonine protein kinase 40(STK40) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Serine/threonine protein kinase 40(STK40) ELISA kit

E04S0412-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Serine/threonine protein kinase 40(STK40) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Serine/threonine protein kinase 40(STK40) ELISA kit

E04S0412-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Serine/threonine protein kinase 40(STK40) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monoclonal STK40 Antibody (monoclonal) (M04), Clone: 4G3

AMM04153G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human STK40 (monoclonal) (M04). The antibodies are raised in mouse and are from clone 4G3. This antibody is applicable in WB and IHC

Stk40 ORF Vector (Rat) (pORF)

ORF077166 1.0 ug DNA
EUR 506

h STK40 inducible lentiviral particles

LVP202 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, STK40, is fully sequence verified and matched to NCBI accession ID: NM_032017

STK40 ORF Vector (Human) (pORF)

ORF010148 1.0 ug DNA
EUR 95

STK40 ORF Vector (Human) (pORF)

ORF010149 1.0 ug DNA
EUR 95

Stk40 ORF Vector (Mouse) (pORF)

ORF058704 1.0 ug DNA
EUR 506

Stk40 ORF Vector (Mouse) (pORF)

ORF058705 1.0 ug DNA
EUR 506

Stk40 sgRNA CRISPR Lentivector set (Rat)

K6422301 3 x 1.0 ug
EUR 339

STK40 sgRNA CRISPR Lentivector set (Human)

K2304901 3 x 1.0 ug
EUR 339

Stk40 sgRNA CRISPR Lentivector set (Mouse)

K4693801 3 x 1.0 ug
EUR 339

Stk40 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6422302 1.0 ug DNA
EUR 154

Stk40 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6422303 1.0 ug DNA
EUR 154

Stk40 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6422304 1.0 ug DNA
EUR 154

STK40 sgRNA CRISPR Lentivector (Human) (Target 1)

K2304902 1.0 ug DNA
EUR 154

STK40 sgRNA CRISPR Lentivector (Human) (Target 2)

K2304903 1.0 ug DNA
EUR 154

STK40 sgRNA CRISPR Lentivector (Human) (Target 3)

K2304904 1.0 ug DNA
EUR 154

Stk40 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4693802 1.0 ug DNA
EUR 154

Stk40 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4693803 1.0 ug DNA
EUR 154

Stk40 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4693804 1.0 ug DNA
EUR 154

STK40 Protein Vector (Rat) (pPB-C-His)

PV308662 500 ng
EUR 603

STK40 Protein Vector (Rat) (pPB-N-His)

PV308663 500 ng
EUR 603

STK40 Protein Vector (Rat) (pPM-C-HA)

PV308664 500 ng
EUR 603

STK40 Protein Vector (Rat) (pPM-C-His)

PV308665 500 ng
EUR 603

STK40 Protein Vector (Human) (pPB-C-His)

PV040589 500 ng
EUR 329

STK40 Protein Vector (Human) (pPB-N-His)

PV040590 500 ng
EUR 329

STK40 Protein Vector (Human) (pPM-C-HA)

PV040591 500 ng
EUR 329

STK40 Protein Vector (Human) (pPM-C-His)

PV040592 500 ng
EUR 329

STK40 Protein Vector (Human) (pPB-C-His)

PV040593 500 ng
EUR 329

STK40 Protein Vector (Human) (pPB-N-His)

PV040594 500 ng
EUR 329

STK40 Protein Vector (Human) (pPM-C-HA)

PV040595 500 ng
EUR 329

STK40 Protein Vector (Human) (pPM-C-His)

PV040596 500 ng
EUR 329

STK40 Protein Vector (Mouse) (pPB-C-His)

PV234814 500 ng
EUR 603

STK40 Protein Vector (Mouse) (pPB-N-His)

PV234815 500 ng
EUR 603

STK40 Protein Vector (Mouse) (pPM-C-HA)

PV234816 500 ng
EUR 603

STK40 Protein Vector (Mouse) (pPM-C-His)

PV234817 500 ng
EUR 603

STK40 Protein Vector (Mouse) (pPB-C-His)

PV234818 500 ng
EUR 603

STK40 Protein Vector (Mouse) (pPB-N-His)

PV234819 500 ng
EUR 603

STK40 Protein Vector (Mouse) (pPM-C-HA)

PV234820 500 ng
EUR 603

STK40 Protein Vector (Mouse) (pPM-C-His)

PV234821 500 ng
EUR 603

Stk40 3'UTR Luciferase Stable Cell Line

TU119860 1.0 ml Ask for price

Stk40 3'UTR GFP Stable Cell Line

TU169860 1.0 ml Ask for price

Stk40 3'UTR Luciferase Stable Cell Line

TU221326 1.0 ml Ask for price

STK40 3'UTR GFP Stable Cell Line

TU074832 1.0 ml
EUR 2333

Stk40 3'UTR GFP Stable Cell Line

TU271326 1.0 ml Ask for price

STK40 3'UTR Luciferase Stable Cell Line

TU024832 1.0 ml
EUR 2333

STK40 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV715521 1.0 ug DNA
EUR 316

STK40 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV715525 1.0 ug DNA
EUR 316

STK40 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV715526 1.0 ug DNA
EUR 316

STK40 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV665677 1.0 ug DNA
EUR 682

STK40 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV665681 1.0 ug DNA
EUR 682

STK40 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV665682 1.0 ug DNA
EUR 682

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

STK40 Rabbit Polyclonal Antibody