STK40 Rabbit Polyclonal Antibody

STK40 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

STK40 Polyclonal Antibody
ES10205-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against STK40 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

STK40 antibody
70R-13420	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal STK40 antibody

STK40 Antibody
36201-100ul	SAB	100ul	EUR 252

STK40 Antibody
1-CSB-PA112765	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against STK40. Recognizes STK40 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200

STK40 Antibody
1-CSB-PA158011	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against STK40. Recognizes STK40 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

Polyclonal STK40 Antibody ( C-term )
APR06136G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STK40 ( C-term ). This antibody is tested and proven to work in the following applications:

STK40 Conjugated Antibody
C36201	SAB	100ul	EUR 397

Anti-STK40 antibody
STJ191363	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to STK40

Stk40/ Rat Stk40 ELISA Kit
ELI-41340r	Lifescience Market	96 Tests	EUR 886

STK40 siRNA
20-abx905335	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

STK40 siRNA
20-abx935491	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

STK40 siRNA
20-abx935492	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-STK40
YF-PA21285	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to STK40

anti-STK40
YF-PA21286	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to STK40

anti-STK40
YF-PA26700	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to STK40

STK40 cloning plasmid
CSB-CL854027HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 702 Sequence: atggtgctcaacaagaggacacatcggataaccatcaccaacttctgcctcgggaagcatctggtgagcgagggggacctgctgaaggaccagagagggagccctgcctacatcagtcccgacgtgctcagcggccggccgtaccgtggcaagcccagtgacatgtgggccctggg Show more
Description: A cloning plasmid for the STK40 gene.

STK40 cloning plasmid
CSB-CL854027HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1308 Sequence: atgaagcggagagcatcagacagaggagctggggaaacgtcggccagggccaaggctctaggaagtgggatttctggaaataatgcaaagagagctggaccattcatccttggtccccgtctgggcaactcaccggtgccaagcatagtgcagtgtttggcgaggaaagatggca Show more
Description: A cloning plasmid for the STK40 gene.

pDONR223-STK40 Plasmid
PVTB00842	Lifescience Market	2 ug	EUR 356

Anti-STK40 (4G3)
YF-MA11688	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to STK40

Serine/threonine Kinase 40 (STK40) Antibody
20-abx214209	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Serine/threonine Kinase 40 (STK40) Antibody
20-abx214607	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Serine/threonine Kinase 40 (STK40) Antibody
abx145680-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Serine/threonine Kinase 40 (STK40) Antibody
abx034199-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Serine/threonine Kinase 40 (STK40) Antibody
abx034199-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Rat STK40 shRNA Plasmid
20-abx990029	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse STK40 shRNA Plasmid
20-abx978130	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human STK40 shRNA Plasmid
20-abx963240	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

STK40 Recombinant Protein (Rat)
RP231494	ABM	100 ug	Ask for price

STK40 Recombinant Protein (Human)
RP030442	ABM	100 ug	Ask for price

STK40 Recombinant Protein (Human)
RP030445	ABM	100 ug	Ask for price

STK40 Recombinant Protein (Mouse)
RP176108	ABM	100 ug	Ask for price

STK40 Recombinant Protein (Mouse)
RP176111	ABM	100 ug	Ask for price

Rabbit Serine/threonine protein kinase 40(STK40) ELISA kit
E04S0412-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Serine/threonine protein kinase 40(STK40) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Serine/threonine protein kinase 40(STK40) ELISA kit
E04S0412-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Serine/threonine protein kinase 40(STK40) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Serine/threonine protein kinase 40(STK40) ELISA kit
E04S0412-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Serine/threonine protein kinase 40(STK40) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monoclonal STK40 Antibody (monoclonal) (M04), Clone: 4G3
AMM04153G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human STK40 (monoclonal) (M04). The antibodies are raised in mouse and are from clone 4G3. This antibody is applicable in WB and IHC

Stk40 ORF Vector (Rat) (pORF)
ORF077166	ABM	1.0 ug DNA	EUR 506

h STK40 inducible lentiviral particles
LVP202	GenTarget	1x107 IFU/ml x 200ul	EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, STK40, is fully sequence verified and matched to NCBI accession ID: NM_032017

STK40 ORF Vector (Human) (pORF)
ORF010148	ABM	1.0 ug DNA	EUR 95

STK40 ORF Vector (Human) (pORF)
ORF010149	ABM	1.0 ug DNA	EUR 95

Stk40 ORF Vector (Mouse) (pORF)
ORF058704	ABM	1.0 ug DNA	EUR 506

Stk40 ORF Vector (Mouse) (pORF)
ORF058705	ABM	1.0 ug DNA	EUR 506

Stk40 sgRNA CRISPR Lentivector set (Rat)
K6422301	ABM	3 x 1.0 ug	EUR 339

STK40 sgRNA CRISPR Lentivector set (Human)
K2304901	ABM	3 x 1.0 ug	EUR 339

Stk40 sgRNA CRISPR Lentivector set (Mouse)
K4693801	ABM	3 x 1.0 ug	EUR 339

Stk40 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6422302	ABM	1.0 ug DNA	EUR 154

Stk40 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6422303	ABM	1.0 ug DNA	EUR 154

Stk40 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6422304	ABM	1.0 ug DNA	EUR 154

STK40 sgRNA CRISPR Lentivector (Human) (Target 1)
K2304902	ABM	1.0 ug DNA	EUR 154

STK40 sgRNA CRISPR Lentivector (Human) (Target 2)
K2304903	ABM	1.0 ug DNA	EUR 154

STK40 sgRNA CRISPR Lentivector (Human) (Target 3)
K2304904	ABM	1.0 ug DNA	EUR 154

Stk40 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4693802	ABM	1.0 ug DNA	EUR 154

Stk40 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4693803	ABM	1.0 ug DNA	EUR 154

Stk40 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4693804	ABM	1.0 ug DNA	EUR 154

STK40 Protein Vector (Rat) (pPB-C-His)
PV308662	ABM	500 ng	EUR 603

STK40 Protein Vector (Rat) (pPB-N-His)
PV308663	ABM	500 ng	EUR 603

STK40 Protein Vector (Rat) (pPM-C-HA)
PV308664	ABM	500 ng	EUR 603

STK40 Protein Vector (Rat) (pPM-C-His)
PV308665	ABM	500 ng	EUR 603

STK40 Protein Vector (Human) (pPB-C-His)
PV040589	ABM	500 ng	EUR 329

STK40 Protein Vector (Human) (pPB-N-His)
PV040590	ABM	500 ng	EUR 329

STK40 Protein Vector (Human) (pPM-C-HA)
PV040591	ABM	500 ng	EUR 329

STK40 Protein Vector (Human) (pPM-C-His)
PV040592	ABM	500 ng	EUR 329

STK40 Protein Vector (Human) (pPB-C-His)
PV040593	ABM	500 ng	EUR 329

STK40 Protein Vector (Human) (pPB-N-His)
PV040594	ABM	500 ng	EUR 329

STK40 Protein Vector (Human) (pPM-C-HA)
PV040595	ABM	500 ng	EUR 329

STK40 Protein Vector (Human) (pPM-C-His)
PV040596	ABM	500 ng	EUR 329

STK40 Protein Vector (Mouse) (pPB-C-His)
PV234814	ABM	500 ng	EUR 603

STK40 Protein Vector (Mouse) (pPB-N-His)
PV234815	ABM	500 ng	EUR 603

STK40 Protein Vector (Mouse) (pPM-C-HA)
PV234816	ABM	500 ng	EUR 603

STK40 Protein Vector (Mouse) (pPM-C-His)
PV234817	ABM	500 ng	EUR 603

STK40 Protein Vector (Mouse) (pPB-C-His)
PV234818	ABM	500 ng	EUR 603

STK40 Protein Vector (Mouse) (pPB-N-His)
PV234819	ABM	500 ng	EUR 603

STK40 Protein Vector (Mouse) (pPM-C-HA)
PV234820	ABM	500 ng	EUR 603

STK40 Protein Vector (Mouse) (pPM-C-His)
PV234821	ABM	500 ng	EUR 603

Stk40 3'UTR Luciferase Stable Cell Line
TU119860	ABM	1.0 ml	Ask for price

Stk40 3'UTR GFP Stable Cell Line
TU169860	ABM	1.0 ml	Ask for price

Stk40 3'UTR Luciferase Stable Cell Line
TU221326	ABM	1.0 ml	Ask for price

STK40 3'UTR GFP Stable Cell Line
TU074832	ABM	1.0 ml	EUR 2333

Stk40 3'UTR GFP Stable Cell Line
TU271326	ABM	1.0 ml	Ask for price

STK40 3'UTR Luciferase Stable Cell Line
TU024832	ABM	1.0 ml	EUR 2333

STK40 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV715521	ABM	1.0 ug DNA	EUR 316

STK40 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV715525	ABM	1.0 ug DNA	EUR 316

STK40 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV715526	ABM	1.0 ug DNA	EUR 316

STK40 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV665677	ABM	1.0 ug DNA	EUR 682

STK40 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV665681	ABM	1.0 ug DNA	EUR 682

STK40 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV665682	ABM	1.0 ug DNA	EUR 682

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

STK40 Rabbit Polyclonal Antibody