January 17, 2022

TM2D1 Rabbit Polyclonal Antibody

TM2D1 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

TM2D1 Polyclonal Antibody

ABP60706-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human TM2D1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TM2D1 from Human, Mouse. This TM2D1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TM2D1 protein

TM2D1 Polyclonal Antibody

ES10359-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TM2D1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

TM2D1 Polyclonal Antibody

ES10359-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TM2D1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

TM2D1 Rabbit pAb

A7840-100ul 100 ul
EUR 308

TM2D1 Rabbit pAb

A7840-200ul 200 ul
EUR 459

TM2D1 Rabbit pAb

A7840-20ul 20 ul
EUR 183

TM2D1 Rabbit pAb

A7840-50ul 50 ul
EUR 223

TM2D1 Antibody

46276-100ul 100ul
EUR 252

TM2D1 Antibody

46276-50ul 50ul
EUR 187

TM2D1 Antibody

DF9962 200ul
EUR 304
Description: TM2D1 Antibody detects endogenous levels of total TM2D1.

TM2D1 antibody

70R-51127 100 ul
EUR 244
Description: Purified Polyclonal TM2D1 antibody

TM2D1 Antibody

ABD9962 100 ug
EUR 438

TM2D1 Conjugated Antibody

C46276 100ul
EUR 397

Anti-TM2D1 antibody

STJ110150 100 µl
EUR 277
Description: The protein encoded by this gene is a beta-amyloid peptide-binding protein. It contains a structural module related to that of the seven transmembrane domain G protein-coupled receptor superfamily and known to be important in heterotrimeric G protein activation. Beta-amyloid peptide has been established to be a causative factor in neuron death and the consequent diminution of cognitive abilities observed in Alzheimer's disease. This protein may be a target of neurotoxic beta-amyloid peptide, and may mediate cellular vulnerability to beta-amyloid peptide toxicity through a G protein-regulated program of cell death. Several transcript variants have been found for this gene.

Anti-TM2D1 antibody

STJ191517 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TM2D1

TM2D1 siRNA

20-abx936913
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TM2D1 siRNA

20-abx936914
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pENTR223- TM2D1

PVT11429 2 ug
EUR 273

TM2D1 Blocking Peptide

DF9962-BP 1mg
EUR 195

TM2D1 Blocking Peptide

20-abx064002
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

TM2D1 cloning plasmid

CSB-CL887145HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 624
  • Sequence: atggcggccgcctggccgtctggtccgtctgctccggaggccgtgacggccagactcgttggtgtcctgtggttcgtctcagtcactacaggaccctggggggctgttgccacctccgccgggggcgaggagtcgcttaagtgcgaggacctcaaagtgggacaatatatttgtaa
  • Show more
Description: A cloning plasmid for the TM2D1 gene.

Mouse TM2D1 shRNA Plasmid

20-abx979259
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human TM2D1 shRNA Plasmid

20-abx963248
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TM2D1 Recombinant Protein (Rat)

RP233294 100 ug Ask for price

pECMV-3-FLAG-TM2D1

PVT13362 2 ug
EUR 599

TM2D1 Recombinant Protein (Human)

RP031696 100 ug Ask for price

TM2D1 Recombinant Protein (Mouse)

RP178994 100 ug Ask for price

TM2 Domain-Containing Protein 1 (TM2D1) Antibody

20-abx007079
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

TM2 Domain-Containing Protein 1 (TM2D1) Antibody

20-abx008013
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

TM2 Domain-Containing Protein 1 (TM2D1) Antibody

20-abx219012
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tm2d1 ORF Vector (Rat) (pORF)

ORF077766 1.0 ug DNA
EUR 506

TM2D1 ORF Vector (Human) (pORF)

ORF010566 1.0 ug DNA
EUR 95

Tm2d1 ORF Vector (Mouse) (pORF)

ORF059666 1.0 ug DNA
EUR 506

Tm2d1 sgRNA CRISPR Lentivector set (Rat)

K6403001 3 x 1.0 ug
EUR 339

Tm2d1 sgRNA CRISPR Lentivector set (Mouse)

K3151701 3 x 1.0 ug
EUR 339

TM2D1 sgRNA CRISPR Lentivector set (Human)

K2380901 3 x 1.0 ug
EUR 339

Tm2d1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6403002 1.0 ug DNA
EUR 154

Tm2d1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6403003 1.0 ug DNA
EUR 154

Tm2d1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6403004 1.0 ug DNA
EUR 154

Tm2d1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3151702 1.0 ug DNA
EUR 154

Tm2d1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3151703 1.0 ug DNA
EUR 154

Tm2d1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3151704 1.0 ug DNA
EUR 154

TM2D1 sgRNA CRISPR Lentivector (Human) (Target 1)

K2380902 1.0 ug DNA
EUR 154

TM2D1 sgRNA CRISPR Lentivector (Human) (Target 2)

K2380903 1.0 ug DNA
EUR 154

TM2D1 sgRNA CRISPR Lentivector (Human) (Target 3)

K2380904 1.0 ug DNA
EUR 154

TM2D1 3'UTR Luciferase Stable Cell Line

TU025654 1.0 ml
EUR 1394

Tm2d1 3'UTR Luciferase Stable Cell Line

TU120557 1.0 ml Ask for price

Tm2d1 3'UTR GFP Stable Cell Line

TU170557 1.0 ml Ask for price

Tm2d1 3'UTR Luciferase Stable Cell Line

TU221949 1.0 ml Ask for price

TM2D1 3'UTR GFP Stable Cell Line

TU075654 1.0 ml
EUR 1394

Tm2d1 3'UTR GFP Stable Cell Line

TU271949 1.0 ml Ask for price

TM2D1 Protein Vector (Rat) (pPB-C-His)

PV311062 500 ng
EUR 603

TM2D1 Protein Vector (Rat) (pPB-N-His)

PV311063 500 ng
EUR 603

TM2D1 Protein Vector (Rat) (pPM-C-HA)

PV311064 500 ng
EUR 603

TM2D1 Protein Vector (Rat) (pPM-C-His)

PV311065 500 ng
EUR 603

TM2D1 Protein Vector (Human) (pPB-C-His)

PV042261 500 ng
EUR 329

TM2D1 Protein Vector (Human) (pPB-N-His)

PV042262 500 ng
EUR 329

TM2D1 Protein Vector (Human) (pPM-C-HA)

PV042263 500 ng
EUR 329

TM2D1 Protein Vector (Human) (pPM-C-His)

PV042264 500 ng
EUR 329

TM2D1 Protein Vector (Mouse) (pPB-C-His)

PV238662 500 ng
EUR 603

TM2D1 Protein Vector (Mouse) (pPB-N-His)

PV238663 500 ng
EUR 603

TM2D1 Protein Vector (Mouse) (pPM-C-HA)

PV238664 500 ng
EUR 603

TM2D1 Protein Vector (Mouse) (pPM-C-His)

PV238665 500 ng
EUR 603

TM2D1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV646447 1.0 ug DNA
EUR 514

TM2D1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV646451 1.0 ug DNA
EUR 514

TM2D1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV646452 1.0 ug DNA
EUR 514

Mouse TM2 domain- containing protein 1, Tm2d1 ELISA KIT

ELI-17342m 96 Tests
EUR 865

Human TM2 domain- containing protein 1, TM2D1 ELISA KIT

ELI-51764h 96 Tests
EUR 824

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

TM2D1 Rabbit Polyclonal Antibody