October 23, 2021

RFTN2 Rabbit Polyclonal Antibody

RFTN2 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

RFTN2 Rabbit pAb

A14340-200ul 200 ul
EUR 459

RFTN2 Rabbit pAb

A14340-20ul 20 ul
EUR 183

RFTN2 Rabbit pAb

A14340-50ul 50 ul
EUR 223

RFTN2 Rabbit pAb

A14445-100ul 100 ul
EUR 308

RFTN2 Rabbit pAb

A14445-200ul 200 ul
EUR 459

RFTN2 Rabbit pAb

A14445-20ul 20 ul
EUR 183

RFTN2 Rabbit pAb

A14445-50ul 50 ul
EUR 223

RFTN2 antibody

70R-19862 50 ul
EUR 435
Description: Rabbit polyclonal RFTN2 antibody

RFTN2 Antibody

46168-100ul 100ul
EUR 252

RFTN2 Antibody

46168-50ul 50ul
EUR 187

RFTN2 Antibody

1-CSB-PA687456LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RFTN2. Recognizes RFTN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

RFTN2 Antibody

DF9799 200ul
EUR 304
Description: RFTN2 Antibody detects endogenous levels of total RFTN2.

RFTN2 antibody

70R-4543 50 ug
EUR 467
Description: Rabbit polyclonal RFTN2 antibody raised against the N terminal of RFTN2

RFTN2 Antibody

1-CSB-PA019606GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RFTN2. Recognizes RFTN2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RFTN2 Antibody

ABD13231 100 ug
EUR 438

RFTN2 Antibody

ABD9799 100 ug
EUR 438

RFTN2 Polyclonal Antibody, HRP Conjugated

A65079 100 µg
EUR 570.55
Description: Ask the seller for details

RFTN2 Polyclonal Antibody, FITC Conjugated

A65080 100 µg
EUR 570.55
Description: The best epigenetics products

RFTN2 Polyclonal Antibody, Biotin Conjugated

A65081 100 µg
EUR 570.55
Description: kits suitable for this type of research

RFTN2 Conjugated Antibody

C46168 100ul
EUR 397

anti- RFTN2 antibody

FNab07256 100µg
EUR 548.75
  • Immunogen: raftlin family member 2
  • Uniprot ID: Q52LD8
  • Gene ID: 130132
  • Research Area: Cell Division and Proliferation
Description: Antibody raised against RFTN2

Anti-RFTN2 antibody

PAab07256 100 ug
EUR 386

Anti-RFTN2 antibody

STJ116552 100 µl
EUR 277

Anti-RFTN2 antibody

STJ116655 100 µl
EUR 277

Anti-RFTN2 antibody

STJ191244 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RFTN2

RFTN2 siRNA

20-abx931332
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RFTN2 siRNA

20-abx931333
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RFTN2 Antibody, HRP conjugated

1-CSB-PA687456LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RFTN2. Recognizes RFTN2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RFTN2 Antibody, FITC conjugated

1-CSB-PA687456LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RFTN2. Recognizes RFTN2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RFTN2 Antibody, Biotin conjugated

1-CSB-PA687456LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RFTN2. Recognizes RFTN2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RFTN2 Blocking Peptide

33R-6014 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RFTN2 antibody, catalog no. 70R-4543

RFTN2 Blocking Peptide

DF9799-BP 1mg
EUR 195

RFTN2 cloning plasmid

CSB-CL687456HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1506
  • Sequence: ATGGGGTGCGGACTTAGAAAGCTAGAAGACCCTGATGATAGCAGCCCTGGAAAAATATTTTCTACCCTGAAGAGACCGCAAGTGGAAACAAAGACAGAATTTGCTTACGAATATGTATTGCTGGATTTTACTCTACAAGCTTCATCAAACCCAGAAGTCATCAAGATAAATTCAA
  • Show more
Description: A cloning plasmid for the RFTN2 gene.

RFTN2 ELISA KIT|Human

EF002426 96 Tests
EUR 689

Mouse RFTN2 shRNA Plasmid

20-abx978054
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RFTN2 shRNA Plasmid

20-abx965022
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RFTN2 Recombinant Protein (Human)

RP042826 100 ug Ask for price

RFTN2 Recombinant Protein (Mouse)

RP167762 100 ug Ask for price

Raftlin Family Member 2 (RFTN2) Antibody

20-abx218268
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Raftlin Family Member 2 (RFTN2) Antibody

abx122225-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Raftlin Family Member 2 (RFTN2) Antibody

abx237256-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Raftlin Family Member 2 (RFTN2) Antibody

20-abx307387
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Raftlin Family Member 2 (RFTN2) Antibody (HRP)

20-abx307388
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Raftlin Family Member 2 (RFTN2) Antibody (FITC)

20-abx307389
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RFTN2 Rabbit Polyclonal Antibody