October 17, 2021

RALB Rabbit Polyclonal Antibody

RALB Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

RALB Polyclonal Antibody

ES10137-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RALB from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RALB Polyclonal Antibody

ES10137-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RALB from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RALB Rabbit pAb

A4069-100ul 100 ul
EUR 308

RALB Rabbit pAb

A4069-200ul 200 ul
EUR 459

RALB Rabbit pAb

A4069-20ul 20 ul
EUR 183

RALB Rabbit pAb

A4069-50ul 50 ul
EUR 223

RALB Rabbit pAb

A6714-100ul 100 ul
EUR 308

RALB Rabbit pAb

A6714-200ul 200 ul
EUR 459

RALB Rabbit pAb

A6714-20ul 20 ul
EUR 183

RALB Rabbit pAb

A6714-50ul 50 ul
EUR 223

RALB antibody

22306-100ul 100ul
EUR 390

RALB Antibody

31152-100ul 100ul
EUR 252

RALB Antibody

31152-50ul 50ul
EUR 187

RALB antibody

70R-13249 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal RALB antibody

RALB antibody

70R-19755 50 ul
EUR 435
Description: Rabbit polyclonal RALB antibody

RALB antibody

39125-100ul 100ul
EUR 252

RALB Antibody

DF9839 200ul
EUR 304
Description: RALB Antibody detects endogenous levels of total RALB.

RALB Antibody

1-CSB-PA283609
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RALB. Recognizes RALB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:500-1:5000, WB:1:500-1:2000

RALB Antibody

1-CSB-PA219431
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RALB. Recognizes RALB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:500-1:5000, WB:1:500-1:2000, IHC:1:10-1:50

RALB antibody

70R-4028 50 ug
EUR 467
Description: Rabbit polyclonal RALB antibody

RALB antibody

70R-50305 100 ul
EUR 244
Description: Purified Polyclonal RALB antibody

RALB Antibody

1-CSB-PA019297ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RALB. Recognizes RALB from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

RALB Antibody

1-CSB-PA019297GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RALB. Recognizes RALB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RALB Antibody

ABD9839 100 ug
EUR 438

Polyclonal Ralb Antibody - middle region

APR01321G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Ralb - middle region. This antibody is tested and proven to work in the following applications:

RALB Conjugated Antibody

C31152 100ul
EUR 397

RALB Conjugated Antibody

C39125 100ul
EUR 397

anti- RALB antibody

FNab07094 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: v-ral simian leukemia viral oncogene homolog B (ras related
  • GTP binding protein)
  • Uniprot ID: P11234
  • Gene ID: 5899
  • Research Area: Signal Transduction, Developmental biology
Description: Antibody raised against RALB

Anti-RALB antibody

PAab07094 100 ug
EUR 412

Anti-RALB Antibody

PB9795 100ug/vial
EUR 294

Anti-RALB antibody

STJ28797 100 µl
EUR 277
Description: This gene encodes a GTP-binding protein that belongs to the small GTPase superfamily and Ras family of proteins. GTP-binding proteins mediate the transmembrane signaling initiated by the occupancy of certain cell surface receptors.

Anti-RALB antibody

STJ116230 100 µl
EUR 277
Description: This gene encodes a GTP-binding protein that belongs to the small GTPase superfamily and Ras family of proteins. GTP-binding proteins mediate the transmembrane signaling initiated by the occupancy of certain cell surface receptors.

Anti-RALB antibody

STJ191295 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RALB

RALB siRNA

20-abx904455
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RALB siRNA

20-abx930822
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RALB siRNA

20-abx930823
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-RALB

YF-PA14289 50 ul
EUR 363
Description: Mouse polyclonal to RALB

anti-RALB

YF-PA14290 50 ug
EUR 363
Description: Mouse polyclonal to RALB

anti-RALB

YF-PA14291 100 ug
EUR 403
Description: Rabbit polyclonal to RALB

RALB Blocking Peptide

33R-3044 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RALB antibody, catalog no. 70R-4028

RALB Blocking Peptide

DF9839-BP 1mg
EUR 195

RALB Blocking Peptide

20-abx063180
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

RALB cloning plasmid

CSB-CL019297HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 621
  • Sequence: atggctgccaacaagagtaagggccagagctccttggccctccacaaggtgatcatggttggcagcggaggcgttggcaagtcagccctgacgcttcagttcatgtatgacgagtttgtagaagactatgaacctaccaaagctgacagttatagaaagaaagtggttcttgatgg
  • Show more
Description: A cloning plasmid for the RALB gene.

Anti-RALB (4D1)

YF-MA10767 100 ug
EUR 363
Description: Mouse monoclonal to RALB

[One Step] RALB Antibody Kit

RK05694 50 ul
EUR 240

RALB protein (His tag)

80R-1599 50 ug
EUR 397
Description: Purified recombinant Human RALB protein

RALB ELISA KIT|Human

EF002298 96 Tests
EUR 689

Mouse RALB shRNA Plasmid

20-abx975262
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat RALB shRNA Plasmid

20-abx987269
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RALB shRNA Plasmid

20-abx953987
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RALB Recombinant Protein (Human)

RP025702 100 ug Ask for price

RALB Recombinant Protein (Mouse)

RP166604 100 ug Ask for price

RALB Recombinant Protein (Rat)

RP223532 100 ug Ask for price

RAS Like Proto-Oncogene B (RALB) Antibody

20-abx008788
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

RAS Like Proto-Oncogene B (RALB) Antibody

20-abx005151
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAS Like Proto-Oncogene B (RALB) Antibody

abx218165-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

RAS Like Proto-Oncogene B (RALB) Antibody

20-abx116639
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAS Like Proto-Oncogene B (RALB) Antibody

abx122440-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

RAS Like Proto-Oncogene B (RALB) Antibody

20-abx242448
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAS Like Proto-Oncogene B (RALB) Antibody

20-abx242457
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAS Like Proto-Oncogene B (RALB) Antibody

abx237094-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

RAS Like Proto-Oncogene B (RALB) Antibody

20-abx322404
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ras-Related Protein Ral-B (RALB) Antibody

abx224342-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

RAS Like Proto-Oncogene B (RALB) Antibody

abx224452-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Monoclonal RALB Antibody (clone 4D1), Clone: 4D1

AMM02024G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human RALB (clone 4D1). The antibodies are raised in Mouse and are from clone 4D1. This antibody is applicable in WB and IHC-P, E, IP

Monoclonal RALB Antibody (monoclonal) (M04), Clone: 4D1

AMM03984G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human RALB (monoclonal) (M04). The antibodies are raised in mouse and are from clone 4D1. This antibody is applicable in WB and IHC, IP, E

Ralb ORF Vector (Rat) (pORF)

ORF074512 1.0 ug DNA
EUR 506

RALB ORF Vector (Human) (pORF)

ORF008568 1.0 ug DNA
EUR 95

Ralb ORF Vector (Mouse) (pORF)

ORF055536 1.0 ug DNA
EUR 506

Ralb sgRNA CRISPR Lentivector set (Rat)

K7075901 3 x 1.0 ug
EUR 339

RALB sgRNA CRISPR Lentivector set (Human)

K1782401 3 x 1.0 ug
EUR 339

Ralb sgRNA CRISPR Lentivector set (Mouse)

K4507801 3 x 1.0 ug
EUR 339

Human Ras-related protein Ral-B (RALB)

1-CSB-EP019297HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 50.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Ras-related protein Ral-B(RALB) expressed in E.coli

Ralb sgRNA CRISPR Lentivector (Rat) (Target 1)

K7075902 1.0 ug DNA
EUR 154

Ralb sgRNA CRISPR Lentivector (Rat) (Target 2)

K7075903 1.0 ug DNA
EUR 154

Ralb sgRNA CRISPR Lentivector (Rat) (Target 3)

K7075904 1.0 ug DNA
EUR 154

RALB sgRNA CRISPR Lentivector (Human) (Target 1)

K1782402 1.0 ug DNA
EUR 154

RALB sgRNA CRISPR Lentivector (Human) (Target 2)

K1782403 1.0 ug DNA
EUR 154

RALB sgRNA CRISPR Lentivector (Human) (Target 3)

K1782404 1.0 ug DNA
EUR 154

Ralb sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4507802 1.0 ug DNA
EUR 154

Ralb sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4507803 1.0 ug DNA
EUR 154

Ralb sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4507804 1.0 ug DNA
EUR 154

RALB Protein Vector (Rat) (pPB-C-His)

PV298046 500 ng
EUR 603

RALB Protein Vector (Rat) (pPB-N-His)

PV298047 500 ng
EUR 603

RALB Protein Vector (Rat) (pPM-C-HA)

PV298048 500 ng
EUR 603

RALB Protein Vector (Rat) (pPM-C-His)

PV298049 500 ng
EUR 603

RALB Protein Vector (Human) (pPB-C-His)

PV034269 500 ng
EUR 329

RALB Protein Vector (Human) (pPB-N-His)

PV034270 500 ng
EUR 329

RALB Protein Vector (Human) (pPM-C-HA)

PV034271 500 ng
EUR 329

RALB Protein Vector (Human) (pPM-C-His)

PV034272 500 ng
EUR 329

RALB Protein Vector (Mouse) (pPB-C-His)

PV222142 500 ng
EUR 603

RALB Protein Vector (Mouse) (pPB-N-His)

PV222143 500 ng
EUR 603

RALB Protein Vector (Mouse) (pPM-C-HA)

PV222144 500 ng
EUR 603

RALB Protein Vector (Mouse) (pPM-C-His)

PV222145 500 ng
EUR 603

Ralb 3'UTR Luciferase Stable Cell Line

TU117499 1.0 ml Ask for price

RALB Rabbit Polyclonal Antibody