PCM1 Rabbit Polyclonal Antibody

PCM1 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

PCM1 Polyclonal Antibody
ES9976-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against PCM1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PCM1 Rabbit pAb
A5696-100ul	Abclonal	100 ul	EUR 308

PCM1 Rabbit pAb
A5696-200ul	Abclonal	200 ul	EUR 459

PCM1 Rabbit pAb
A5696-20ul	Abclonal	20 ul	EUR 183

PCM1 Rabbit pAb
A5696-50ul	Abclonal	50 ul	EUR 223

PCM1 Rabbit pAb
A16637-100ul	Abclonal	100 ul	EUR 308

PCM1 Rabbit pAb
A16637-200ul	Abclonal	200 ul	EUR 459

PCM1 Rabbit pAb
A16637-20ul	Abclonal	20 ul	EUR 183

PCM1 Rabbit pAb
A16637-50ul	Abclonal	50 ul	EUR 223

PCM1 Antibody
32982-100ul	SAB	100ul	EUR 252

PCM1 Antibody
1-CSB-PA618977DSR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PCM1. Recognizes PCM1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

PCM1 Antibody
DF7464	Affbiotech	200ul	EUR 304
Description: PCM1 Antibody detects endogenous levels of total PCM1.

PCM1 Antibody
ABD7464	Lifescience Market	100 ug	EUR 438

PCM1 Conjugated Antibody
C32982	SAB	100ul	EUR 397

anti- PCM1 antibody
FNab06212	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 Immunogen: pericentriolar material 1 Uniprot ID: Q15154 Gene ID: 5108 Research Area: Epigenetics
Description: Antibody raised against PCM1

Anti-PCM1 antibody
PAab06212	Lifescience Market	100 ug	EUR 386

Anti-PCM1 antibody
STJ27663	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a component of centriolar satellites, which are electron dense granules scattered around centrosomes. Inhibition studies show that this protein is essential for the correct localization of several centrosomal proteins, and for anchoring microtubules to the centrosome. Chromosomal aberrations involving this gene are associated with papillary thyroid carcinomas and a variety of hematological malignancies, including atypical chronic myeloid leukemia and T-cell lymphoma. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-PCM1 antibody
STJ119072	St John's Laboratory	100 µl	EUR 277

Anti-PCM1 antibody
STJ191134	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to PCM1

PCM1 siRNA
20-abx927961	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PCM1 siRNA
20-abx927962	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

pOTB7-PCM1
PVT18447	Lifescience Market	2 ug	EUR 231

anti-PCM1
YF-PA13648	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to PCM1

Pericentriolar Material 1 (PCM1) Polyclonal Antibody (Human)
4-PAC715Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PCM1 (Pro1913~Ile2024) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pericentriolar Material 1 (PCM1)

Pericentriolar Material 1 (PCM1) Polyclonal Antibody (Rat)
4-PAC715Ra01	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PCM1 (Gln15~Val210) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pericentriolar Material 1 (PCM1)

Pericentriolar Material 1 (PCM1) Polyclonal Antibody (Human), APC
4-PAC715Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PCM1 (Pro1913~Ile2024) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pericentriolar Material 1 (PCM1). This antibody is labeled with APC.

Pericentriolar Material 1 (PCM1) Polyclonal Antibody (Human), Biotinylated
4-PAC715Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PCM1 (Pro1913~Ile2024) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pericentriolar Material 1 (PCM1). This antibody is labeled with Biotin.

Pericentriolar Material 1 (PCM1) Polyclonal Antibody (Human), Cy3
4-PAC715Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PCM1 (Pro1913~Ile2024) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pericentriolar Material 1 (PCM1). This antibody is labeled with Cy3.

Pericentriolar Material 1 (PCM1) Polyclonal Antibody (Human), FITC
4-PAC715Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PCM1 (Pro1913~Ile2024) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pericentriolar Material 1 (PCM1). This antibody is labeled with FITC.

Pericentriolar Material 1 (PCM1) Polyclonal Antibody (Human), HRP
4-PAC715Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PCM1 (Pro1913~Ile2024) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pericentriolar Material 1 (PCM1). This antibody is labeled with HRP.

Pericentriolar Material 1 (PCM1) Polyclonal Antibody (Human), PE
4-PAC715Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PCM1 (Pro1913~Ile2024) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pericentriolar Material 1 (PCM1). This antibody is labeled with PE.

Pericentriolar Material 1 (PCM1) Polyclonal Antibody (Rat), APC
4-PAC715Ra01-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PCM1 (Gln15~Val210) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pericentriolar Material 1 (PCM1). This antibody is labeled with APC.

Pericentriolar Material 1 (PCM1) Polyclonal Antibody (Rat), Biotinylated
4-PAC715Ra01-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PCM1 (Gln15~Val210) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pericentriolar Material 1 (PCM1). This antibody is labeled with Biotin.

Pericentriolar Material 1 (PCM1) Polyclonal Antibody (Rat), Cy3
4-PAC715Ra01-Cy3	Cloud-Clone	EUR 444.00 EUR 4685.00 EUR 1265.00 EUR 581.00 EUR 261.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PCM1 (Gln15~Val210) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pericentriolar Material 1 (PCM1). This antibody is labeled with Cy3.

Pericentriolar Material 1 (PCM1) Polyclonal Antibody (Rat), FITC
4-PAC715Ra01-FITC	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PCM1 (Gln15~Val210) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pericentriolar Material 1 (PCM1). This antibody is labeled with FITC.

Pericentriolar Material 1 (PCM1) Polyclonal Antibody (Rat), HRP
4-PAC715Ra01-HRP	Cloud-Clone	EUR 332.00 EUR 3089.00 EUR 866.00 EUR 421.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PCM1 (Gln15~Val210) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pericentriolar Material 1 (PCM1). This antibody is labeled with HRP.

Pericentriolar Material 1 (PCM1) Polyclonal Antibody (Rat), PE
4-PAC715Ra01-PE	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PCM1 (Gln15~Val210) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pericentriolar Material 1 (PCM1). This antibody is labeled with PE.

PCM1 Blocking Peptide
DF7464-BP	Affbiotech	1mg	EUR 195

PCM1 cloning plasmid
CSB-CL618977HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1593 Sequence: atggccacaggaggaggtccctttgaagatggcatgaatgatcaggatttaccaaactggagtaatgagaatgttgatgacaggctcaacaatatggattggggtgcccaacagaagaaagcaaatagatcatcagaaaagaataagaaaaagtttggtgtagaaagtgataaaa Show more
Description: A cloning plasmid for the PCM1 gene.

pENTR223-PCM1 vector
PVT11802	Lifescience Market	2 ug	EUR 304

Pericentriolar Material 1 (PCM1) Antibody
20-abx131505	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Pericentriolar Material 1 (PCM1) Antibody
20-abx131506	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Pericentriolar Material 1 (PCM1) Polyclonal Antibody (Human), APC-Cy7
4-PAC715Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PCM1 (Pro1913~Ile2024) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pericentriolar Material 1 (PCM1). This antibody is labeled with APC-Cy7.

Pericentriolar Material 1 (PCM1) Polyclonal Antibody (Rat), APC-Cy7
4-PAC715Ra01-APC-Cy7	Cloud-Clone	EUR 608.00 EUR 6970.00 EUR 1840.00 EUR 814.00 EUR 335.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PCM1 (Gln15~Val210) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pericentriolar Material 1 (PCM1). This antibody is labeled with APC-Cy7.

PCM1 ELISA KIT|Human
EF001609	Lifescience Market	96 Tests	EUR 689

Mouse PCM1 shRNA Plasmid
20-abx971944	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human PCM1 shRNA Plasmid
20-abx953399	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

pECMV-3-FLAG-PCM1
PVT13554	Lifescience Market	2 ug	EUR 599

Pericentriolar Material 1 Protein (PCM1) Antibody
20-abx004357	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Pericentriolar Material 1 Protein (PCM1) Antibody
20-abx142128	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Pericentriolar Material 1 Protein (PCM1) Antibody
20-abx320670	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Pericentriolar Material 1 Protein (PCM1) Antibody
abx236212-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Pcm1 ORF Vector (Rat) (pORF)
ORF073211	ABM	1.0 ug DNA	EUR 2210

PCM1 ORF Vector (Human) (pORF)
ORF007587	ABM	1.0 ug DNA	EUR 95

Pcm1 ORF Vector (Mouse) (pORF)
ORF053564	ABM	1.0 ug DNA	EUR 2209

Recombinant Pericentriolar Material 1 (PCM1)
4-RPC715Hu01	Cloud-Clone	EUR 458.40 EUR 226.00 EUR 1444.00 EUR 548.00 EUR 996.00 EUR 370.00 EUR 3460.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q15154 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 16.0kDa Isoelectric Point: Inquire
Description: Recombinant Human Pericentriolar Material 1 expressed in: E.coli

Recombinant Pericentriolar Material 1 (PCM1)
4-RPC715Ra01	Cloud-Clone	EUR 503.20 EUR 238.00 EUR 1612.00 EUR 604.00 EUR 1108.00 EUR 400.00 EUR 3880.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: G3V7E6 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 25.7kDa Isoelectric Point: Inquire
Description: Recombinant Rat Pericentriolar Material 1 expressed in: E.coli

PCM1 ELISA Kit (Human) (OKCA01412)
OKCA01412	Aviva Systems Biology	96 Wells	EUR 846
Description: Description of target: Required for centrosome assembly and function. Essential for the correct localization of several centrosomal proteins including CEP250, CETN3, PCNT and NEK2. Required to anchor microtubules to the centrosome. Involved in the biogenesis of cilia.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 3.9 pg/mL

Human Pericentriolar Material 1 (PCM1) Protein
20-abx650135	Abbexa	EUR 648.00 EUR 272.00 EUR 1943.00 EUR 759.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Rat Pericentriolar Material 1 (PCM1) Protein
20-abx650136	Abbexa	EUR 704.00 EUR 286.00 EUR 2165.00 EUR 829.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Pcm1 sgRNA CRISPR Lentivector set (Mouse)
K4895301	ABM	3 x 1.0 ug	EUR 339

Pcm1 sgRNA CRISPR Lentivector set (Rat)
K7113401	ABM	3 x 1.0 ug	EUR 339

PCM1 sgRNA CRISPR Lentivector set (Human)
K1611301	ABM	3 x 1.0 ug	EUR 339

Pcm1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4895302	ABM	1.0 ug DNA	EUR 154

Pcm1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4895303	ABM	1.0 ug DNA	EUR 154

Pcm1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4895304	ABM	1.0 ug DNA	EUR 154

Pcm1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7113402	ABM	1.0 ug DNA	EUR 154

Pcm1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7113403	ABM	1.0 ug DNA	EUR 154

Pcm1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7113404	ABM	1.0 ug DNA	EUR 154

PCM1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1611302	ABM	1.0 ug DNA	EUR 154

PCM1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1611303	ABM	1.0 ug DNA	EUR 154

PCM1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1611304	ABM	1.0 ug DNA	EUR 154

PCM1 Protein Vector (Rat) (pPB-C-His)
PV292842	ABM	500 ng	EUR 3339

PCM1 Protein Vector (Rat) (pPB-N-His)
PV292843	ABM	500 ng	EUR 3339

PCM1 Protein Vector (Rat) (pPM-C-HA)
PV292844	ABM	500 ng	EUR 3339

PCM1 Protein Vector (Rat) (pPM-C-His)
PV292845	ABM	500 ng	EUR 3339

PCM1 Protein Vector (Mouse) (pPB-C-His)
PV214254	ABM	500 ng	EUR 3337

PCM1 Protein Vector (Mouse) (pPB-N-His)
PV214255	ABM	500 ng	EUR 3337

PCM1 Protein Vector (Mouse) (pPM-C-HA)
PV214256	ABM	500 ng	EUR 3337

PCM1 Protein Vector (Mouse) (pPM-C-His)
PV214257	ABM	500 ng	EUR 3337

PCM1 Protein Vector (Human) (pPB-C-His)
PV030345	ABM	500 ng	EUR 329

PCM1 Protein Vector (Human) (pPB-N-His)
PV030346	ABM	500 ng	EUR 329

PCM1 Protein Vector (Human) (pPM-C-HA)
PV030347	ABM	500 ng	EUR 329

PCM1 Protein Vector (Human) (pPM-C-His)
PV030348	ABM	500 ng	EUR 329

Pcm1 3'UTR Luciferase Stable Cell Line
TU116049	ABM	1.0 ml	Ask for price

Pcm1 3'UTR GFP Stable Cell Line
TU166049	ABM	1.0 ml	Ask for price

Pcm1 3'UTR Luciferase Stable Cell Line
TU215941	ABM	1.0 ml	Ask for price

Pcm1 3'UTR GFP Stable Cell Line
TU265941	ABM	1.0 ml	Ask for price

PCM1 3'UTR GFP Stable Cell Line
TU067564	ABM	1.0 ml	EUR 4617

PCM1 3'UTR Luciferase Stable Cell Line
TU017564	ABM	1.0 ml	EUR 4617

Human Pericentriolar material 1 protein, PCM1 ELISA KIT
ELI-21518h	Lifescience Market	96 Tests	EUR 824

Mouse Pericentriolar material 1 protein, Pcm1 ELISA KIT
ELI-21879m	Lifescience Market	96 Tests	EUR 865

Chicken Pericentriolar material 1 protein, PCM1 ELISA KIT
ELI-45850c	Lifescience Market	96 Tests	EUR 928

Human Pericentriolar material 1 protein (PCM1) ELISA Kit
abx382097-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

PCM1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV626701	ABM	1.0 ug DNA	EUR 3103

PCM1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV626705	ABM	1.0 ug DNA	EUR 3103

PCM1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV626706	ABM	1.0 ug DNA	EUR 3103

PCM1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV792331	ABM	1.0 ug DNA	EUR 316

PCM1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV792332	ABM	1.0 ug DNA	EUR 316

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

PCM1 Rabbit Polyclonal Antibody