October 23, 2021

PECR Rabbit Polyclonal Antibody

PECR Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

PECR Polyclonal Antibody

ABP59875-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PECR protein at amino acid sequence of 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of PECR from Human, Mouse, Rat. This PECR antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PECR protein at amino acid sequence of 40-120

PECR Polyclonal Antibody

ABP59875-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PECR protein at amino acid sequence of 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of PECR from Human, Mouse, Rat. This PECR antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PECR protein at amino acid sequence of 40-120

PECR Polyclonal Antibody

ES9983-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PECR from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PECR Polyclonal Antibody

ES9983-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PECR from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PECR Rabbit pAb

A7206-100ul 100 ul
EUR 308

PECR Rabbit pAb

A7206-200ul 200 ul
EUR 459

PECR Rabbit pAb

A7206-20ul 20 ul
EUR 183

PECR Rabbit pAb

A7206-50ul 50 ul
EUR 223

PECR Polyclonal Conjugated Antibody

C30855 100ul
EUR 397

PECR antibody

22145-100ul 100ul
EUR 390

PECR antibody

70R-19207 50 ul
EUR 435
Description: Rabbit polyclonal PECR antibody

PECR antibody

70R-13465 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal PECR antibody

PECR antibody

10R-5232 100 ul
EUR 726
Description: Mouse monoclonal PECR antibody

PECR antibody

10R-5233 100 ul
EUR 691
Description: Mouse monoclonal PECR antibody

PECR antibody

10R-5235 100 ul
EUR 691
Description: Mouse monoclonal PECR antibody

PECR Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PECR. Recognizes PECR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

PECR Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PECR. Recognizes PECR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

PECR Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PECR. Recognizes PECR from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

PECR Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PECR. Recognizes PECR from Human. This antibody is Unconjugated. Tested in the following application: ELISA

PECR Polyclonal Antibody, Biotin Conjugated

A60227 100 µg
EUR 570.55
Description: fast delivery possible

PECR Polyclonal Antibody, FITC Conjugated

A60228 100 µg
EUR 570.55
Description: reagents widely cited

PECR Polyclonal Antibody, HRP Conjugated

A60229 100 µg
EUR 570.55
Description: Ask the seller for details

Polyclonal PECR antibody - C-terminal region

APR09035G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PECR - C-terminal region. This antibody is tested and proven to work in the following applications:

Pecr/ Rat Pecr ELISA Kit

ELI-37732r 96 Tests
EUR 886

Human PECR Antibody

33241-05111 150 ug
EUR 261

anti- PECR antibody

FNab06300 100µg
EUR 548.75
  • Immunogen: peroxisomal trans-2-enoyl-CoA reductase
  • Uniprot ID: Q9BY49
  • Gene ID: 55825
  • Research Area: Metabolism
Description: Antibody raised against PECR

Anti-PECR antibody

PAab06300 100 ug
EUR 386

Anti-PECR antibody

STJ29286 100 µl
EUR 277

Anti-PECR antibody

STJ191141 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PECR


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


PVT18639 2 ug
EUR 231

PECR Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PECR. Recognizes PECR from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PECR Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PECR. Recognizes PECR from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PECR Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PECR. Recognizes PECR from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PECR cloning plasmid

CSB-CL017769HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 912
  • Sequence: atggcctcctgggctaagggcaggagctacctggcgcctggtttgctgcagggccaagtggccatcgtcaccggcggggccacgggcatcggaaaagccatcgtgaaggagctcctggagctggggagtaatgtggtcattgcatcccgtaagttggagagattgaagtctgcggc
  • Show more
Description: A cloning plasmid for the PECR gene.

Anti-PECR (2F10)

YF-MA18843 200 ul
EUR 363
Description: Mouse monoclonal to PECR

Human PECR Antibody (Biotin Conjugate)

33241-05121 150 ug
EUR 369

PECR protein (His tag)

80R-1994 100 ug
EUR 322
Description: Recombinant human PECR protein (His tag)


EF001670 96 Tests
EUR 689

Rat PECR shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PECR shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PECR shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PECR Recombinant Protein (Human)

RP023053 100 ug Ask for price

PECR Recombinant Protein (Mouse)

RP161288 100 ug Ask for price

PECR Recombinant Protein (Rat)

RP220010 100 ug Ask for price

Human PECR AssayLite Antibody (FITC Conjugate)

33241-05141 150 ug
EUR 428

Human PECR AssayLite Antibody (RPE Conjugate)

33241-05151 150 ug
EUR 428

Human PECR AssayLite Antibody (APC Conjugate)

33241-05161 150 ug
EUR 428

Human PECR AssayLite Antibody (PerCP Conjugate)

33241-05171 150 ug
EUR 471

Pecr ORF Vector (Rat) (pORF)

ORF073338 1.0 ug DNA
EUR 506

PECR ORF Vector (Human) (pORF)

ORF007685 1.0 ug DNA
EUR 95

Pecr ORF Vector (Mouse) (pORF)

ORF053764 1.0 ug DNA
EUR 506

Peroxisomal Trans-2-Enoyl-CoA Reductase (PECR) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Peroxisomal Trans-2-Enoyl-CoA Reductase (PECR) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Peroxisomal Trans-2-Enoyl-CoA Reductase (PECR) Antibody

abx236300-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Peroxisomal Trans-2-Enoyl-CoA Reductase (PECR) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Peroxisomal Trans-2-Enoyl-CoA Reductase (PECR) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Pecr sgRNA CRISPR Lentivector set (Mouse)

K4951401 3 x 1.0 ug
EUR 339

Pecr sgRNA CRISPR Lentivector set (Rat)

K7028401 3 x 1.0 ug
EUR 339

PECR sgRNA CRISPR Lentivector set (Human)

K1626201 3 x 1.0 ug
EUR 339

Peroxisomal Trans-2-Enoyl-CoA Reductase (PECR) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Peroxisomal Trans-2-Enoyl-CoA Reductase (PECR) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Peroxisomal Trans-2-Enoyl-CoA Reductase (PECR) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Pecr sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4951402 1.0 ug DNA
EUR 154

Pecr sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4951403 1.0 ug DNA
EUR 154

Pecr sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4951404 1.0 ug DNA
EUR 154

Pecr sgRNA CRISPR Lentivector (Rat) (Target 1)

K7028402 1.0 ug DNA
EUR 154

Pecr sgRNA CRISPR Lentivector (Rat) (Target 2)

K7028403 1.0 ug DNA
EUR 154

Pecr sgRNA CRISPR Lentivector (Rat) (Target 3)

K7028404 1.0 ug DNA
EUR 154

PECR sgRNA CRISPR Lentivector (Human) (Target 1)

K1626202 1.0 ug DNA
EUR 154

PECR sgRNA CRISPR Lentivector (Human) (Target 2)

K1626203 1.0 ug DNA
EUR 154

PECR sgRNA CRISPR Lentivector (Human) (Target 3)

K1626204 1.0 ug DNA
EUR 154

PECR Protein Vector (Rat) (pPB-C-His)

PV293350 500 ng
EUR 603

PECR Protein Vector (Rat) (pPB-N-His)

PV293351 500 ng
EUR 603

PECR Protein Vector (Rat) (pPM-C-HA)

PV293352 500 ng
EUR 603

PECR Protein Vector (Rat) (pPM-C-His)

PV293353 500 ng
EUR 603

PECR Protein Vector (Mouse) (pPB-C-His)

PV215054 500 ng
EUR 603

PECR Protein Vector (Mouse) (pPB-N-His)

PV215055 500 ng
EUR 603

PECR Protein Vector (Mouse) (pPM-C-HA)

PV215056 500 ng
EUR 603

PECR Protein Vector (Mouse) (pPM-C-His)

PV215057 500 ng
EUR 603

PECR Protein Vector (Human) (pPB-C-His)

PV030737 500 ng
EUR 329

PECR Protein Vector (Human) (pPB-N-His)

PV030738 500 ng
EUR 329

PECR Protein Vector (Human) (pPM-C-HA)

PV030739 500 ng
EUR 329

PECR Protein Vector (Human) (pPM-C-His)

PV030740 500 ng
EUR 329

Recombinant Human PECR Protein, His, E.coli-1mg

QP13004-1mg 1mg
EUR 2757

Recombinant Human PECR Protein, His, E.coli-20ug

QP13004-20ug 20ug
EUR 201

Recombinant Human PECR Protein, His, E.coli-5ug

QP13004-5ug 5ug
EUR 155

Pecr 3'UTR Luciferase Stable Cell Line

TU116181 1.0 ml Ask for price

Pecr 3'UTR GFP Stable Cell Line

TU166181 1.0 ml Ask for price

Pecr 3'UTR Luciferase Stable Cell Line

TU216068 1.0 ml Ask for price

Pecr 3'UTR GFP Stable Cell Line

TU266068 1.0 ml Ask for price

PECR 3'UTR GFP Stable Cell Line

TU067719 1.0 ml
EUR 1394

PECR 3'UTR Luciferase Stable Cell Line

TU017719 1.0 ml
EUR 1394

PECR Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV666409 1.0 ug DNA
EUR 514

PECR Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV666413 1.0 ug DNA
EUR 514

PECR Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV666414 1.0 ug DNA
EUR 514

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

PECR Rabbit Polyclonal Antibody