January 17, 2022

RAB23 Rabbit Polyclonal Antibody

RAB23 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

RAB23 Polyclonal Antibody

ES10118-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RAB23 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

RAB23 Rabbit pAb

A7979-100ul 100 ul
EUR 308

RAB23 Rabbit pAb

A7979-200ul 200 ul
EUR 459

RAB23 Rabbit pAb

A7979-20ul 20 ul
EUR 183

RAB23 Rabbit pAb

A7979-50ul 50 ul
EUR 223

RAB23 antibody

70R-19693 50 ul
EUR 435
Description: Rabbit polyclonal RAB23 antibody

RAB23 Antibody

46180-100ul 100ul
EUR 252

RAB23 Antibody

46180-50ul 50ul
EUR 187

RAB23 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RAB23. Recognizes RAB23 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

RAB23 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RAB23. Recognizes RAB23 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RAB23 Antibody

DF9821 200ul
EUR 304
Description: RAB23 Antibody detects endogenous levels of total RAB23.

RAB23 antibody

70R-51001 100 ul
EUR 244
Description: Purified Polyclonal RAB23 antibody

Rab23 antibody

70R-9451 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Rab23 antibody

RAB23 antibody

70R-5787 50 ug
EUR 467
Description: Rabbit polyclonal RAB23 antibody raised against the N terminal of RAB23

RAB23 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RAB23. Recognizes RAB23 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RAB23 Antibody

ABD9821 100 ug
EUR 438

Polyclonal Rab23 antibody - middle region

APR13043G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Rab23 - middle region. This antibody is tested and proven to work in the following applications:

Polyclonal Goat Anti-RAB23 Antibody

AMM05952G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-RAB23 . This antibody is tested and proven to work in the following applications:

RAB23, Member RAS Oncogene Family (RAB23) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB23, Member RAS Oncogene Family (RAB23) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

RAB23, Member RAS Oncogene Family (RAB23) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rab23, Member Ras Oncogene Family (RAB23) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB23, Member RAS Oncogene Family (RAB23) Antibody

abx145153-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

RAB23, Member RAS Oncogene Family (RAB23) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB23, Member RAS Oncogene Family (Rab23) Antibody

abx237006-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

RAB23, Member RAS Oncogene Family (RAB23) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB23, Member RAS Oncogene Family (RAB23) Antibody

abx431545-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Human RAB23 Antibody

33318-05111 150 ug
EUR 261

RAB23 Conjugated Antibody

C46180 100ul
EUR 397

anti- Rab23 antibody

FNab07006 100µg
EUR 505.25
  • Immunogen: RAB23, member RAS oncogene family
  • Uniprot ID: Q9ULC3
  • Gene ID: 51715
  • Research Area: Signal Transduction, Developmental biology
Description: Antibody raised against Rab23

Anti-Rab23 antibody

PAab07006 100 ug
EUR 355

Anti-RAB23 antibody

STJ110286 100 µl
EUR 277
Description: This gene encodes a small GTPase of the Ras superfamily. Rab proteins are involved in the regulation of diverse cellular functions associated with intracellular membrane trafficking, including autophagy and immune response to bacterial infection. The encoded protein may play a role in central nervous system development by antagonizing sonic hedgehog signaling. Disruption of this gene has been implicated in Carpenter syndrome as well as cancer. Alternative splicing results in multiple transcript variants.

Anti-RAB23 antibody

STJ71452 100 µg
EUR 359

Anti-RAB23 antibody

STJ191276 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RAB23


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA19178 50 ul
EUR 363
Description: Mouse polyclonal to RAB23


YF-PA19179 50 ug
EUR 363
Description: Mouse polyclonal to RAB23


YF-PA19180 50 ul
EUR 363
Description: Mouse polyclonal to RAB23


YF-PA19181 100 ul
EUR 403
Description: Rabbit polyclonal to RAB23


YF-PA19182 100 ug
EUR 403
Description: Rabbit polyclonal to RAB23

Rab23 Blocking Peptide

33R-2100 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Rab23 antibody, catalog no. 70R-9451

RAB23 Blocking Peptide

33R-9136 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAB23 antibody, catalog no. 70R-5787

RAB23 cloning plasmid

CSB-CL891960HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 714
  • Sequence: atgttggaggaagatatggaagtcgccataaagatggtggttgtagggaatggagcagttggaaaatcaagtatgattcagcgatattgcaaaggcatttttacaaaagactacaagaaaaccattggagttgattttttggagcgacaaattcaagttaatgatgaagatgtcag
  • Show more
Description: A cloning plasmid for the RAB23 gene.

RAB23 Blocking Peptide

DF9821-BP 1mg
EUR 195

RAB23 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.


PVT13991 2 ug
EUR 391

Human RAB23 Antibody (Biotin Conjugate)

33318-05121 150 ug
EUR 369

RAB23 protein (His tag)

80R-2032 100 ug
EUR 322
Description: Recombinant human RAB23 protein (His tag)

Rab23 ELISA KIT|Human

EF002224 96 Tests
EUR 689

Human RAB23 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RAB23 Recombinant Protein (Human)

RP025444 100 ug Ask for price

RAB23 Recombinant Protein (Mouse)

RP166226 100 ug Ask for price

RAB23 Recombinant Protein (Mouse)

RP166229 100 ug Ask for price

RAB23 Recombinant Protein (Rat)

RP223277 100 ug Ask for price

Human RAB23 AssayLite Antibody (FITC Conjugate)

33318-05141 150 ug
EUR 428

Human RAB23 AssayLite Antibody (RPE Conjugate)

33318-05151 150 ug
EUR 428

Human RAB23 AssayLite Antibody (APC Conjugate)

33318-05161 150 ug
EUR 428

Human RAB23 AssayLite Antibody (PerCP Conjugate)

33318-05171 150 ug
EUR 471

Rab23 ORF Vector (Rat) (pORF)

ORF074427 1.0 ug DNA
EUR 506

RAB23 ORF Vector (Human) (pORF)

ORF008482 1.0 ug DNA
EUR 95

Rab23 ORF Vector (Mouse) (pORF)

ORF055410 1.0 ug DNA
EUR 506

Rab23 ORF Vector (Mouse) (pORF)

ORF055411 1.0 ug DNA
EUR 506

RAB23, Member RAS Oncogene Family Protein

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Rab23 sgRNA CRISPR Lentivector set (Mouse)

K4787401 3 x 1.0 ug
EUR 339

Rab23 sgRNA CRISPR Lentivector set (Rat)

K6513601 3 x 1.0 ug
EUR 339

RAB23 sgRNA CRISPR Lentivector set (Human)

K1772601 3 x 1.0 ug
EUR 339

Human Ras-related protein Rab-23 (RAB23)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 53.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Ras-related protein Rab-23(RAB23) expressed in E.coli

Rab23 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4787402 1.0 ug DNA
EUR 154

Rab23 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4787403 1.0 ug DNA
EUR 154

Rab23 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4787404 1.0 ug DNA
EUR 154

Rab23 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6513602 1.0 ug DNA
EUR 154

Rab23 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6513603 1.0 ug DNA
EUR 154

Rab23 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6513604 1.0 ug DNA
EUR 154

RAB23 sgRNA CRISPR Lentivector (Human) (Target 1)

K1772602 1.0 ug DNA
EUR 154

RAB23 sgRNA CRISPR Lentivector (Human) (Target 2)

K1772603 1.0 ug DNA
EUR 154

RAB23 sgRNA CRISPR Lentivector (Human) (Target 3)

K1772604 1.0 ug DNA
EUR 154

RAB23 Rabbit Polyclonal Antibody