October 17, 2021

PIGA Rabbit Polyclonal Antibody

PIGA Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

PIGA Polyclonal Antibody
ES9989-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PIGA from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
PIGA Polyclonal Antibody
ABP59910-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human PIGA protein at amino acid sequence of 410-490
  • Applications tips:
Description: A polyclonal antibody for detection of PIGA from Human, Mouse. This PIGA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PIGA protein at amino acid sequence of 410-490
PIGA Polyclonal Antibody
ABP59910-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PIGA protein at amino acid sequence of 410-490
  • Applications tips:
Description: A polyclonal antibody for detection of PIGA from Human, Mouse. This PIGA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PIGA protein at amino acid sequence of 410-490
PIGA Polyclonal Antibody
ABP59910-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PIGA protein at amino acid sequence of 410-490
  • Applications tips:
Description: A polyclonal antibody for detection of PIGA from Human, Mouse. This PIGA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PIGA protein at amino acid sequence of 410-490
PIGA Rabbit pAb
A6236-100ul 100 ul
EUR 308
PIGA Rabbit pAb
A6236-200ul 200 ul
EUR 459
PIGA Rabbit pAb
A6236-20ul 20 ul
EUR 183
PIGA Rabbit pAb
A6236-50ul 50 ul
EUR 223
PIGA Antibody
ABD9742 100 ug
EUR 438
PIGA antibody
70R-6607 50 ug
EUR 467
Description: Rabbit polyclonal PIGA antibody raised against the middle region of PIGA
PIGA antibody
70R-8625 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal PIGA antibody
PIGA Antibody
46125-100ul 100ul
EUR 252
PIGA Antibody
46125-50ul 50ul
EUR 187
PIGA antibody
70R-19281 50 ul
EUR 435
Description: Rabbit polyclonal PIGA antibody
PIGA Antibody
DF9742 200ul
EUR 304
Description: PIGA Antibody detects endogenous levels of total PIGA.
PIGA Antibody
1-CSB-PA017965GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PIGA. Recognizes PIGA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
PIGA Antibody
1-CSB-PA017965LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGA. Recognizes PIGA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200
Polyclonal PIGA Antibody (C-term)
APR03682G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PIGA (C-term). This antibody is tested and proven to work in the following applications:
PIGA Conjugated Antibody
C46125 100ul
EUR 397
anti- PIGA antibody
FNab06438 100µg
EUR 548.75
  • Immunogen: phosphatidylinositol glycan anchor biosynthesis, class A
  • Uniprot ID: P37287
  • Gene ID: 5277
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against PIGA
Anti-PIGA antibody
PAab06438 100 ug
EUR 386
Anti-PIGA antibody
STJ27992 100 µl
EUR 277
Description: This gene encodes a protein required for synthesis of N-acetylglucosaminyl phosphatidylinositol (GlcNAc-PI), the first intermediate in the biosynthetic pathway of GPI anchor. The GPI anchor is a glycolipid found on many blood cells and which serves to anchor proteins to the cell surface. Paroxysmal nocturnal hemoglobinuria, an acquired hematologic disorder, has been shown to result from mutations in this gene. Alternate splice variants have been characterized. A related pseudogene is located on chromosome 12.
Anti-PIGA antibody
STJ191147 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PIGA
PIGA siRNA
20-abx928557
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PIGA siRNA
20-abx928558
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PIGA Antibody, HRP conjugated
1-CSB-PA017965LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGA. Recognizes PIGA from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
PIGA Antibody, FITC conjugated
1-CSB-PA017965LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGA. Recognizes PIGA from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
PIGA Antibody, Biotin conjugated
1-CSB-PA017965LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGA. Recognizes PIGA from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
PIGA cloning plasmid
CSB-CL017965HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1455
  • Sequence: atggcctgtagaggaggagctgggaatggccaccgtgcctcagctacactctctcgggttagccctggaagtctttacacatgtagaacccgtacccataatatatgcatggtatctgactttttctacccaaatatgggaggcgtggaaagccacatttaccagctctctcagt
  • Show more
Description: A cloning plasmid for the PIGA gene.
PIGA Blocking Peptide
33R-8916 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PIGA antibody, catalog no. 70R-6607
PIGA Blocking Peptide
DF9742-BP 1mg
EUR 195
PIGA ELISA KIT|Human
EF001774 96 Tests
EUR 689
Human PIGA ELISA KIT
ELI-36281h 96 Tests
EUR 824
Mouse Piga ELISA KIT
ELI-37394m 96 Tests
EUR 865
Human PIGA shRNA Plasmid
20-abx953526
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse PIGA shRNA Plasmid
20-abx972029
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
PIGA Recombinant Protein (Human)
RP023434 100 ug Ask for price
PIGA Recombinant Protein (Rat)
RP220463 100 ug Ask for price
PIGA Recombinant Protein (Mouse)
RP162014 100 ug Ask for price
PIGA ORF Vector (Human) (pORF)
ORF007812 1.0 ug DNA
EUR 95
Piga ORF Vector (Rat) (pORF)
ORF073489 1.0 ug DNA
EUR 506
Piga ORF Vector (Mouse) (pORF)
ORF054006 1.0 ug DNA
EUR 506
Phosphatidylinositol Glycan Anchor Biosynthesis Class A (Piga) Antibody
20-abx114440
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody
20-abx006618
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody
abx026766-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody
abx026766-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody
20-abx217763
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody
20-abx333889
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody
abx236438-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
PIGA sgRNA CRISPR Lentivector set (Human)
K1646601 3 x 1.0 ug
EUR 339
Piga sgRNA CRISPR Lentivector set (Mouse)
K4985401 3 x 1.0 ug
EUR 339
Piga sgRNA CRISPR Lentivector set (Rat)
K6656901 3 x 1.0 ug
EUR 339
Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody (HRP)
20-abx337009
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody (FITC)
20-abx337010
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody (Biotin)
20-abx337011
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
PIGA sgRNA CRISPR Lentivector (Human) (Target 1)
K1646602 1.0 ug DNA
EUR 154
PIGA sgRNA CRISPR Lentivector (Human) (Target 2)
K1646603 1.0 ug DNA
EUR 154
PIGA sgRNA CRISPR Lentivector (Human) (Target 3)
K1646604 1.0 ug DNA
EUR 154
Piga sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4985402 1.0 ug DNA
EUR 154
Piga sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4985403 1.0 ug DNA
EUR 154
Piga sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4985404 1.0 ug DNA
EUR 154
Piga sgRNA CRISPR Lentivector (Rat) (Target 1)
K6656902 1.0 ug DNA
EUR 154
Piga sgRNA CRISPR Lentivector (Rat) (Target 2)
K6656903 1.0 ug DNA
EUR 154
Piga sgRNA CRISPR Lentivector (Rat) (Target 3)
K6656904 1.0 ug DNA
EUR 154
PIGA Protein Vector (Human) (pPB-C-His)
PV031245 500 ng
EUR 329
PIGA Protein Vector (Human) (pPB-N-His)
PV031246 500 ng
EUR 329
PIGA Protein Vector (Human) (pPM-C-HA)
PV031247 500 ng
EUR 329
PIGA Protein Vector (Human) (pPM-C-His)
PV031248 500 ng
EUR 329
PIGA Protein Vector (Mouse) (pPB-C-His)
PV216022 500 ng
EUR 603
PIGA Protein Vector (Mouse) (pPB-N-His)
PV216023 500 ng
EUR 603
PIGA Protein Vector (Mouse) (pPM-C-HA)
PV216024 500 ng
EUR 603
PIGA Protein Vector (Mouse) (pPM-C-His)
PV216025 500 ng
EUR 603
PIGA Protein Vector (Rat) (pPB-C-His)
PV293954 500 ng
EUR 603
PIGA Protein Vector (Rat) (pPB-N-His)
PV293955 500 ng
EUR 603
PIGA Protein Vector (Rat) (pPM-C-HA)
PV293956 500 ng
EUR 603
PIGA Protein Vector (Rat) (pPM-C-His)
PV293957 500 ng
EUR 603
Piga 3'UTR GFP Stable Cell Line
TU166345 1.0 ml Ask for price
PIGA 3'UTR Luciferase Stable Cell Line
TU017926 1.0 ml
EUR 4617
Piga 3'UTR Luciferase Stable Cell Line
TU116345 1.0 ml Ask for price
PIGA 3'UTR GFP Stable Cell Line
TU067926 1.0 ml
EUR 4617
Piga 3'UTR GFP Stable Cell Line
TU266224 1.0 ml Ask for price
Piga 3'UTR Luciferase Stable Cell Line
TU216224 1.0 ml Ask for price
PIGA Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV622225 1.0 ug DNA
EUR 514
PIGA Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV622229 1.0 ug DNA
EUR 514
PIGA Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV622230 1.0 ug DNA
EUR 514
VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

PIGA Rabbit Polyclonal Antibody