October 26, 2021

RGS17 Rabbit Polyclonal Antibody

RGS17 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

RGS17 Polyclonal Antibody

ABP60153-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human RGS17 protein at amino acid sequence of 70-150
  • Applications tips:
Description: A polyclonal antibody for detection of RGS17 from Human, Mouse. This RGS17 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RGS17 protein at amino acid sequence of 70-150

RGS17 Polyclonal Antibody

ABP60153-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RGS17 protein at amino acid sequence of 70-150
  • Applications tips:
Description: A polyclonal antibody for detection of RGS17 from Human, Mouse. This RGS17 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RGS17 protein at amino acid sequence of 70-150

RGS17 Polyclonal Antibody

ABP60153-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RGS17 protein at amino acid sequence of 70-150
  • Applications tips:
Description: A polyclonal antibody for detection of RGS17 from Human, Mouse. This RGS17 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RGS17 protein at amino acid sequence of 70-150

RGS17 Polyclonal Antibody

ES10147-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RGS17 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

RGS17 Polyclonal Antibody

ES10147-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RGS17 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

RGS17 Rabbit pAb

A15815-100ul 100 ul
EUR 308

RGS17 Rabbit pAb

A15815-200ul 200 ul
EUR 459

RGS17 Rabbit pAb

A15815-20ul 20 ul
EUR 183

RGS17 Rabbit pAb

A15815-50ul 50 ul
EUR 223

RGS17 Polyclonal Conjugated Antibody

C29434 100ul
EUR 397

RGS17 antibody

22501-100ul 100ul
EUR 390

RGS17 antibody

70R-13010 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal RGS17 antibody

RGS17 Antibody

DF9844 200ul
EUR 304
Description: RGS17 Antibody detects endogenous levels of total RGS17.

RGS17 antibody

70R-51373 100 ul
EUR 244
Description: Purified Polyclonal RGS17 antibody

RGS17 Antibody

ABD9844 100 ug
EUR 438

Polyclonal RGS17 / RGSZ2 Antibody (C-Term)

AMM07585G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human RGS17 / RGSZ2 (C-Term). This antibody is tested and proven to work in the following applications:

Polyclonal RGS17 Antibody - C-terminal region

AMM07586G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RGS17 - C-terminal region. This antibody is tested and proven to work in the following applications:

anti- RGS17 antibody

FNab07268 100µg
EUR 548.75
  • Immunogen: regulator of G-protein signaling 17
  • Uniprot ID: Q9UGC6
  • Gene ID: 26575
  • Research Area: Signal Transduction
Description: Antibody raised against RGS17

Anti-RGS17 antibody

PAab07268 100 ug
EUR 386

Anti-RGS17 antibody

STJ118274 100 µl
EUR 277

Anti-RGS17 antibody

STJ191305 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RGS17

RGS17 siRNA

20-abx931398
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RGS17 siRNA

20-abx931399
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-RGS17

YF-PA26007 50 ul
EUR 334
Description: Mouse polyclonal to RGS17

Human RGS17/RGSZ2 Antibody

32841-05111 150 ug
EUR 261

Anti-RGS17 / RGSZ2 antibody

STJ70549 100 µg
EUR 260

RGS17 Blocking Peptide

DF9844-BP 1mg
EUR 195

RGS17 Blocking Peptide

20-abx064248
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

RGS17 cloning plasmid

CSB-CL019648HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 633
  • Sequence: atgcgaaaaaggcagcagtcccaaaatgaaggaacacctgccgtgtctcaagctcctggaaaccagaggcccaacaacacctgttgcttttgttggtgctgttgttgcagctgctcctgcctcactgtgaggaatgaagaaagaggggaaaatgcgggaagacccacacacactac
  • Show more
Description: A cloning plasmid for the RGS17 gene.

pCMV-SPORT6-RGS17

PVT13751 2 ug
EUR 391

Anti-RGS17 (2H4)

YF-MA18126 200 ul
EUR 363
Description: Mouse monoclonal to RGS17

Human RGS17/RGSZ2 Antibody (Biotin Conjugate)

32841-05121 150 ug
EUR 369

RGS17 protein (His tag)

80R-1956 100 ug
EUR 322
Description: Recombinant human RGS17 protein

RGS17 ELISA KIT|Human

EF002437 96 Tests
EUR 689

Mouse RGS17 shRNA Plasmid

20-abx974830
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RGS17 shRNA Plasmid

20-abx958861
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RGS17 Recombinant Protein (Human)

RP026308 100 ug Ask for price

RGS17 Recombinant Protein (Mouse)

RP167882 100 ug Ask for price

RGS17 Recombinant Protein (Mouse)

RP167885 100 ug Ask for price

RGS17 Recombinant Protein (Rat)

RP225941 100 ug Ask for price

Human RGS17/RGSZ2 AssayLite Antibody (FITC Conjugate)

32841-05141 150 ug
EUR 428

Human RGS17/RGSZ2 AssayLite Antibody (RPE Conjugate)

32841-05151 150 ug
EUR 428

Human RGS17/RGSZ2 AssayLite Antibody (APC Conjugate)

32841-05161 150 ug
EUR 428

Human RGS17/RGSZ2 AssayLite Antibody (PerCP Conjugate)

32841-05171 150 ug
EUR 471

Rgs17 ORF Vector (Rat) (pORF)

ORF075315 1.0 ug DNA
EUR 506

RGS17 ORF Vector (Human) (pORF)

ORF008770 1.0 ug DNA
EUR 95

Rgs17 ORF Vector (Mouse) (pORF)

ORF055962 1.0 ug DNA
EUR 506

Rgs17 ORF Vector (Mouse) (pORF)

ORF055963 1.0 ug DNA
EUR 506

Rabbit Regulator of G protein signaling 17(RGS17) ELISA kit

E04R0408-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Regulator of G protein signaling 17(RGS17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Regulator of G protein signaling 17(RGS17) ELISA kit

E04R0408-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Regulator of G protein signaling 17(RGS17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Regulator of G protein signaling 17(RGS17) ELISA kit

E04R0408-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Regulator of G protein signaling 17(RGS17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Regulator of G Protein Signaling 17 (RGS17) Antibody

20-abx007784
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Regulator of G Protein Signaling 17 (RGS17) Antibody

abx237268-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Regulator of G Protein Signaling 17 (RGS17) Antibody

abx430592-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

Rgs17 sgRNA CRISPR Lentivector set (Rat)

K6344001 3 x 1.0 ug
EUR 339

RGS17 sgRNA CRISPR Lentivector set (Human)

K1818301 3 x 1.0 ug
EUR 339

Rgs17 sgRNA CRISPR Lentivector set (Mouse)

K3445201 3 x 1.0 ug
EUR 339

Rgs17 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6344002 1.0 ug DNA
EUR 154

Rgs17 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6344003 1.0 ug DNA
EUR 154

Rgs17 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6344004 1.0 ug DNA
EUR 154

RGS17 sgRNA CRISPR Lentivector (Human) (Target 1)

K1818302 1.0 ug DNA
EUR 154

RGS17 sgRNA CRISPR Lentivector (Human) (Target 2)

K1818303 1.0 ug DNA
EUR 154

RGS17 sgRNA CRISPR Lentivector (Human) (Target 3)

K1818304 1.0 ug DNA
EUR 154

Rgs17 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3445202 1.0 ug DNA
EUR 154

Rgs17 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3445203 1.0 ug DNA
EUR 154

Rgs17 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3445204 1.0 ug DNA
EUR 154

RGS17 Protein Vector (Rat) (pPB-C-His)

PV301258 500 ng
EUR 603

RGS17 Protein Vector (Rat) (pPB-N-His)

PV301259 500 ng
EUR 603

RGS17 Protein Vector (Rat) (pPM-C-HA)

PV301260 500 ng
EUR 603

RGS17 Protein Vector (Rat) (pPM-C-His)

PV301261 500 ng
EUR 603

RGS17 Protein Vector (Human) (pPB-C-His)

PV035077 500 ng
EUR 329

RGS17 Protein Vector (Human) (pPB-N-His)

PV035078 500 ng
EUR 329

RGS17 Protein Vector (Human) (pPM-C-HA)

PV035079 500 ng
EUR 329

RGS17 Protein Vector (Human) (pPM-C-His)

PV035080 500 ng
EUR 329

RGS17 Protein Vector (Mouse) (pPB-C-His)

PV223846 500 ng
EUR 603

RGS17 Protein Vector (Mouse) (pPB-N-His)

PV223847 500 ng
EUR 603

RGS17 Protein Vector (Mouse) (pPM-C-HA)

PV223848 500 ng
EUR 603

RGS17 Protein Vector (Mouse) (pPM-C-His)

PV223849 500 ng
EUR 603

RGS17 Protein Vector (Mouse) (pPB-C-His)

PV223850 500 ng
EUR 603

RGS17 Protein Vector (Mouse) (pPB-N-His)

PV223851 500 ng
EUR 603

RGS17 Protein Vector (Mouse) (pPM-C-HA)

PV223852 500 ng
EUR 603

RGS17 Protein Vector (Mouse) (pPM-C-His)

PV223853 500 ng
EUR 603

Recombinant Human RGS17 Protein, His, E.coli-1mg

QP13309-1mg 1mg
EUR 2757

Recombinant Human RGS17 Protein, His, E.coli-25ug

QP13309-25ug 25ug
EUR 201

Recombinant Human RGS17 Protein, His, E.coli-5ug

QP13309-5ug 5ug
EUR 155

Rgs17 3'UTR Luciferase Stable Cell Line

TU117795 1.0 ml Ask for price

Rgs17 3'UTR GFP Stable Cell Line

TU167795 1.0 ml Ask for price

Rgs17 3'UTR Luciferase Stable Cell Line

TU219372 1.0 ml Ask for price

Rgs17 3'UTR GFP Stable Cell Line

TU269372 1.0 ml Ask for price

RGS17 3'UTR GFP Stable Cell Line

TU069853 1.0 ml
EUR 1394

RGS17 3'UTR Luciferase Stable Cell Line

TU019853 1.0 ml
EUR 1394

RGS17 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV653689 1.0 ug DNA
EUR 514

RGS17 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV653693 1.0 ug DNA
EUR 514

RGS17 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV653694 1.0 ug DNA
EUR 514

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

RGS17 Rabbit Polyclonal Antibody