October 26, 2021

RGS22 Rabbit Polyclonal Antibody

RGS22 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

Polyclonal RGS22 Antibody
AMM07594G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RGS22 . This antibody is tested and proven to work in the following applications:
RGS22 Polyclonal Antibody
A63326 100 µg
EUR 570.55
Description: reagents widely cited
RGS22 Polyclonal Antibody
ABP60157-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human RGS22 protein at amino acid sequence of 320-400
  • Applications tips:
Description: A polyclonal antibody for detection of RGS22 from Human. This RGS22 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RGS22 protein at amino acid sequence of 320-400
RGS22 Polyclonal Antibody
ABP60157-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RGS22 protein at amino acid sequence of 320-400
  • Applications tips:
Description: A polyclonal antibody for detection of RGS22 from Human. This RGS22 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RGS22 protein at amino acid sequence of 320-400
RGS22 Polyclonal Antibody
ABP60157-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RGS22 protein at amino acid sequence of 320-400
  • Applications tips:
Description: A polyclonal antibody for detection of RGS22 from Human. This RGS22 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RGS22 protein at amino acid sequence of 320-400
RGS22 Polyclonal Antibody
ES10150-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RGS22 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
RGS22 Polyclonal Antibody
ES10150-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RGS22 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
RGS22 Antibody
25527-100ul 100ul
EUR 390
RGS22 Antibody
42736-100ul 100ul
EUR 252
RGS22 Antibody
1-CSB-PA090738
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RGS22. Recognizes RGS22 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100
RGS22 Antibody
DF9848 200ul
EUR 304
Description: RGS22 Antibody detects endogenous levels of total RGS22.
RGS22 Antibody
1-CSB-PA276672
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RGS22. Recognizes RGS22 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
RGS22 antibody
70R-3489 50 ug
EUR 467
Description: Rabbit polyclonal RGS22 antibody raised against the N terminal of RGS22
RGS22 Antibody
1-CSB-PA019654LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RGS22. Recognizes RGS22 from Human. This antibody is Unconjugated. Tested in the following application: ELISA
RGS22 Antibody
ABD9848 100 ug
EUR 438
Polyclonal RGS22 Antibody (N-Terminus)
AMM07595G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RGS22 (N-Terminus). This antibody is tested and proven to work in the following applications:
RGS22 Polyclonal Antibody, HRP Conjugated
A63327 100 µg
EUR 570.55
Description: Ask the seller for details
RGS22 Polyclonal Antibody, FITC Conjugated
A63328 100 µg
EUR 570.55
Description: The best epigenetics products
RGS22 Polyclonal Antibody, Biotin Conjugated
A63329 100 µg
EUR 570.55
Description: kits suitable for this type of research
RGS22 Conjugated Antibody
C42736 100ul
EUR 397
RGS22 Antibody (HRP)
20-abx305116
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
RGS22 Antibody (FITC)
20-abx305117
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
RGS22 Antibody (Biotin)
20-abx305118
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Anti-RGS22 antibody
STJ191308 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RGS22
RGS22 siRNA
20-abx931409
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RGS22 siRNA
20-abx931410
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RGS22 Antibody, HRP conjugated
1-CSB-PA019654LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RGS22. Recognizes RGS22 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
RGS22 Antibody, FITC conjugated
1-CSB-PA019654LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RGS22. Recognizes RGS22 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
RGS22 Antibody, Biotin conjugated
1-CSB-PA019654LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RGS22. Recognizes RGS22 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
RGS22 Blocking Peptide
33R-7764 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RGS22 antibody, catalog no. 70R-3489
RGS22 Blocking Peptide
DF9848-BP 1mg
EUR 195
RGS22 cloning plasmid
CSB-CL019654HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1515
  • Sequence: atgcccgagaagaggctcaccgcggagccaccaactattacagaagaagaatttgaagattctctggcaacagatgatttccttgtagactactttaatgaattcctaagccttccaaccttttcagaggcaattagatttaatgcagattatggagtttttgaagtagctaatg
  • Show more
Description: A cloning plasmid for the RGS22 gene.
RGS22 cloning plasmid
CSB-CL019654HU2-10ug 10ug
EUR 1336
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3795
  • Sequence: ATGCCCGAGAAGAGGCTCACCGCGGAGCCACCAACTATTACAGAAGAAGAATTTGAAGATTCTCTGGCAACAGATGATTTCCTTGTAGACTACTTTAATGAATTCCTAAGCCTTCCAACCTTTTCAGAGGCAATTAGATTTAATGCAGATTATGGAGTTTTTGAAGTAGCTAATG
  • Show more
Description: A cloning plasmid for the RGS22 gene.
Mouse RGS22 shRNA Plasmid
20-abx984185
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human RGS22 shRNA Plasmid
20-abx958745
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
RGS22 ORF Vector (Human) (pORF)
ORF014283 1.0 ug DNA
EUR 354
RGS22 ORF Vector (Human) (pORF)
ORF008775 1.0 ug DNA
EUR 95
Rgs22 ORF Vector (Mouse) (pORF)
ORF055969 1.0 ug DNA
EUR 506
pECMV-Rgs22-m-FLAG Plasmid
PVT15532 2 ug
EUR 325
Regulator of G Protein Signaling 22 (RGS22) Antibody
abx218279-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
Regulator Of G Protein Signaling 22 (RGS22) Antibody
20-abx211144
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Regulator Of G Protein Signaling 22 (RGS22) Antibody
20-abx210557
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Regulator of G Protein Signaling 22 (RGS22) Antibody
20-abx305115
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
RGS22 sgRNA CRISPR Lentivector set (Human)
K1818801 3 x 1.0 ug
EUR 339
Rgs22 sgRNA CRISPR Lentivector set (Mouse)
K3032601 3 x 1.0 ug
EUR 339
RGS22 sgRNA CRISPR Lentivector (Human) (Target 1)
K1818802 1.0 ug DNA
EUR 154
RGS22 sgRNA CRISPR Lentivector (Human) (Target 2)
K1818803 1.0 ug DNA
EUR 154
RGS22 sgRNA CRISPR Lentivector (Human) (Target 3)
K1818804 1.0 ug DNA
EUR 154
Rgs22 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3032602 1.0 ug DNA
EUR 154
Rgs22 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3032603 1.0 ug DNA
EUR 154
Rgs22 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3032604 1.0 ug DNA
EUR 154
RGS22 Protein Vector (Human) (pPB-C-His)
PV035097 500 ng
EUR 329
RGS22 Protein Vector (Human) (pPB-N-His)
PV035098 500 ng
EUR 329
RGS22 Protein Vector (Human) (pPM-C-HA)
PV035099 500 ng
EUR 329
RGS22 Protein Vector (Human) (pPM-C-His)
PV035100 500 ng
EUR 329
RGS22 Protein Vector (Human) (pPB-C-His)
PV057129 500 ng
EUR 481
RGS22 Protein Vector (Human) (pPB-N-His)
PV057130 500 ng
EUR 481
RGS22 Protein Vector (Human) (pPM-C-HA)
PV057131 500 ng
EUR 481
RGS22 Protein Vector (Human) (pPM-C-His)
PV057132 500 ng
EUR 481
RGS22 Protein Vector (Mouse) (pPB-C-His)
PV223874 500 ng
EUR 1065
RGS22 Protein Vector (Mouse) (pPB-N-His)
PV223875 500 ng
EUR 1065
RGS22 Protein Vector (Mouse) (pPM-C-HA)
PV223876 500 ng
EUR 1065
RGS22 Protein Vector (Mouse) (pPM-C-His)
PV223877 500 ng
EUR 1065
Rgs22 3'UTR Luciferase Stable Cell Line
TU117801 1.0 ml Ask for price
Rgs22 3'UTR GFP Stable Cell Line
TU167801 1.0 ml Ask for price
RGS22 3'UTR GFP Stable Cell Line
TU069858 1.0 ml
EUR 1394
RGS22 3'UTR Luciferase Stable Cell Line
TU019858 1.0 ml
EUR 1394
RGS22 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV702105 1.0 ug DNA
EUR 450
RGS22 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV702109 1.0 ug DNA
EUR 450
RGS22 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV702110 1.0 ug DNA
EUR 450
GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252
GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187
EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252
EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187
Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252
Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187
ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252
ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187
EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252
EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187
mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252
mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187
mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252
mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187
AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252
AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187
EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252
EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187
Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252
Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187
LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252
LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187
GAPDH Rabbit Polyclonal Antibody
A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
Rabbit Hemoglobin Polyclonal Antibody
A53073 100 µg
EUR 570.55
Description: The best epigenetics products
Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
NM23A Rabbit Polyclonal Antibody
ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

RGS22 Rabbit Polyclonal Antibody