RGS22 Rabbit Polyclonal Antibody
To Order Contact us: [email protected]
 Polyclonal RGS22 Antibody |
|
AMM07594G |
Leading Biology |
0.1 mg |
EUR 659 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RGS22 . This antibody is tested and proven to work in the following applications: |
 RGS22 Polyclonal Antibody |
|
A63326 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: reagents widely cited |
|
RGS22 Polyclonal Antibody |
|
ABP60157-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human RGS22 protein at amino acid sequence of 320-400
- Applications tips:
|
|
Description: A polyclonal antibody for detection of RGS22 from Human. This RGS22 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RGS22 protein at amino acid sequence of 320-400 |
|
RGS22 Polyclonal Antibody |
|
ABP60157-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human RGS22 protein at amino acid sequence of 320-400
- Applications tips:
|
|
Description: A polyclonal antibody for detection of RGS22 from Human. This RGS22 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RGS22 protein at amino acid sequence of 320-400 |
|
RGS22 Polyclonal Antibody |
|
ABP60157-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human RGS22 protein at amino acid sequence of 320-400
- Applications tips:
|
|
Description: A polyclonal antibody for detection of RGS22 from Human. This RGS22 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RGS22 protein at amino acid sequence of 320-400 |
|
RGS22 Polyclonal Antibody |
|
ES10150-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against RGS22 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
|
RGS22 Polyclonal Antibody |
|
ES10150-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against RGS22 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 RGS22 Antibody |
|
25527-100ul |
SAB |
100ul |
EUR 390 |
|
RGS22 Antibody |
|
42736-100ul |
SAB |
100ul |
EUR 252 |
|
RGS22 Antibody |
|
1-CSB-PA090738 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against RGS22. Recognizes RGS22 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100 |
|
RGS22 Antibody |
|
DF9848 |
Affbiotech |
200ul |
EUR 304 |
|
Description: RGS22 Antibody detects endogenous levels of total RGS22. |
|
RGS22 Antibody |
|
1-CSB-PA276672 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against RGS22. Recognizes RGS22 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
 RGS22 antibody |
|
70R-3489 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal RGS22 antibody raised against the N terminal of RGS22 |
|
RGS22 Antibody |
|
1-CSB-PA019654LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against RGS22. Recognizes RGS22 from Human. This antibody is Unconjugated. Tested in the following application: ELISA |
) Polyclonal RGS22 Antibody (N-Terminus) |
|
AMM07595G |
Leading Biology |
0.05mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RGS22 (N-Terminus). This antibody is tested and proven to work in the following applications: |
 RGS22 Polyclonal Antibody, HRP Conjugated |
|
A63327 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: Ask the seller for details |
 RGS22 Polyclonal Antibody, FITC Conjugated |
|
A63328 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 RGS22 Polyclonal Antibody, Biotin Conjugated |
|
A63329 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: kits suitable for this type of research |
 RGS22 Conjugated Antibody |
|
C42736 |
SAB |
100ul |
EUR 397 |
) RGS22 Antibody (HRP) |
|
20-abx305116 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
) RGS22 Antibody (FITC) |
|
20-abx305117 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
) RGS22 Antibody (Biotin) |
|
20-abx305118 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Anti-RGS22 antibody |
|
STJ191308 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to RGS22 |
 RGS22 siRNA |
|
20-abx931409 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
|
RGS22 siRNA |
|
20-abx931410 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 RGS22 Antibody, HRP conjugated |
|
1-CSB-PA019654LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against RGS22. Recognizes RGS22 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 RGS22 Antibody, FITC conjugated |
|
1-CSB-PA019654LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against RGS22. Recognizes RGS22 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 RGS22 Antibody, Biotin conjugated |
|
1-CSB-PA019654LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against RGS22. Recognizes RGS22 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 RGS22 Blocking Peptide |
|
33R-7764 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RGS22 antibody, catalog no. 70R-3489 |
|
RGS22 Blocking Peptide |
|
DF9848-BP |
Affbiotech |
1mg |
EUR 195 |
 RGS22 cloning plasmid |
|
CSB-CL019654HU1-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1515
- Sequence: atgcccgagaagaggctcaccgcggagccaccaactattacagaagaagaatttgaagattctctggcaacagatgatttccttgtagactactttaatgaattcctaagccttccaaccttttcagaggcaattagatttaatgcagattatggagtttttgaagtagctaatg
- Show more
|
|
Description: A cloning plasmid for the RGS22 gene. |
|
RGS22 cloning plasmid |
|
CSB-CL019654HU2-10ug |
Cusabio |
10ug |
EUR 1336 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 3795
- Sequence: ATGCCCGAGAAGAGGCTCACCGCGGAGCCACCAACTATTACAGAAGAAGAATTTGAAGATTCTCTGGCAACAGATGATTTCCTTGTAGACTACTTTAATGAATTCCTAAGCCTTCCAACCTTTTCAGAGGCAATTAGATTTAATGCAGATTATGGAGTTTTTGAAGTAGCTAATG
- Show more
|
|
Description: A cloning plasmid for the RGS22 gene. |
 Mouse RGS22 shRNA Plasmid |
|
20-abx984185 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human RGS22 shRNA Plasmid |
|
20-abx958745 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 (pORF)) RGS22 ORF Vector (Human) (pORF) |
|
ORF014283 |
ABM |
1.0 ug DNA |
EUR 354 |
|
RGS22 ORF Vector (Human) (pORF) |
|
ORF008775 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Rgs22 ORF Vector (Mouse) (pORF) |
|
ORF055969 |
ABM |
1.0 ug DNA |
EUR 506 |
 Antibody) Regulator of G Protein Signaling 22 (RGS22) Antibody |
|
abx218279-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
 Antibody) Regulator Of G Protein Signaling 22 (RGS22) Antibody |
|
20-abx211144 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
|
Regulator Of G Protein Signaling 22 (RGS22) Antibody |
|
20-abx210557 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
|
Regulator of G Protein Signaling 22 (RGS22) Antibody |
|
20-abx305115 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
) RGS22 sgRNA CRISPR Lentivector set (Human) |
|
K1818801 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Rgs22 sgRNA CRISPR Lentivector set (Mouse) |
|
K3032601 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) RGS22 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K1818802 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) RGS22 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K1818803 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) RGS22 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K1818804 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Rgs22 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3032602 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Rgs22 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3032603 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Rgs22 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3032604 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) RGS22 Protein Vector (Human) (pPB-C-His) |
|
PV035097 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) RGS22 Protein Vector (Human) (pPB-N-His) |
|
PV035098 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) RGS22 Protein Vector (Human) (pPM-C-HA) |
|
PV035099 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) RGS22 Protein Vector (Human) (pPM-C-His) |
|
PV035100 |
ABM |
500 ng |
EUR 329 |
|
RGS22 Protein Vector (Human) (pPB-C-His) |
|
PV057129 |
ABM |
500 ng |
EUR 481 |
|
RGS22 Protein Vector (Human) (pPB-N-His) |
|
PV057130 |
ABM |
500 ng |
EUR 481 |
|
RGS22 Protein Vector (Human) (pPM-C-HA) |
|
PV057131 |
ABM |
500 ng |
EUR 481 |
|
RGS22 Protein Vector (Human) (pPM-C-His) |
|
PV057132 |
ABM |
500 ng |
EUR 481 |
 (pPB-C-His)) RGS22 Protein Vector (Mouse) (pPB-C-His) |
|
PV223874 |
ABM |
500 ng |
EUR 1065 |
 (pPB-N-His)) RGS22 Protein Vector (Mouse) (pPB-N-His) |
|
PV223875 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-HA)) RGS22 Protein Vector (Mouse) (pPM-C-HA) |
|
PV223876 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-His)) RGS22 Protein Vector (Mouse) (pPM-C-His) |
|
PV223877 |
ABM |
500 ng |
EUR 1065 |
 Rgs22 3'UTR Luciferase Stable Cell Line |
|
TU117801 |
ABM |
1.0 ml |
Ask for price |
 Rgs22 3'UTR GFP Stable Cell Line |
|
TU167801 |
ABM |
1.0 ml |
Ask for price |
 RGS22 3'UTR GFP Stable Cell Line |
|
TU069858 |
ABM |
1.0 ml |
EUR 1394 |
 RGS22 3'UTR Luciferase Stable Cell Line |
|
TU019858 |
ABM |
1.0 ml |
EUR 1394 |
 (CMV) (pLenti-GIII-CMV)) RGS22 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
|
LV702105 |
ABM |
1.0 ug DNA |
EUR 450 |
 (UbC) (pLenti-GIII-UbC)) RGS22 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
|
LV702109 |
ABM |
1.0 ug DNA |
EUR 450 |
 (EF1a) (pLenti-GIII-EF1a)) RGS22 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
|
LV702110 |
ABM |
1.0 ug DNA |
EUR 450 |
 GAPDH Rabbit Polyclonal Antibody |
|
37985-100ul |
SAB |
100ul |
EUR 252 |
|
GAPDH Rabbit Polyclonal Antibody |
|
37985-50ul |
SAB |
50ul |
EUR 187 |
 EFHD1 Rabbit Polyclonal Antibody |
|
38001-100ul |
SAB |
100ul |
EUR 252 |
|
EFHD1 Rabbit Polyclonal Antibody |
|
38001-50ul |
SAB |
50ul |
EUR 187 |
 Alliinase Rabbit Polyclonal Antibody |
|
38042-100ul |
SAB |
100ul |
EUR 252 |
|
Alliinase Rabbit Polyclonal Antibody |
|
38042-50ul |
SAB |
50ul |
EUR 187 |
 ECFP Rabbit Polyclonal Antibody |
|
38077-100ul |
SAB |
100ul |
EUR 252 |
|
ECFP Rabbit Polyclonal Antibody |
|
38077-50ul |
SAB |
50ul |
EUR 187 |
 EYFP Rabbit Polyclonal Antibody |
|
38078-100ul |
SAB |
100ul |
EUR 252 |
|
EYFP Rabbit Polyclonal Antibody |
|
38078-50ul |
SAB |
50ul |
EUR 187 |
 mOrange Rabbit Polyclonal Antibody |
|
38079-100ul |
SAB |
100ul |
EUR 252 |
|
mOrange Rabbit Polyclonal Antibody |
|
38079-50ul |
SAB |
50ul |
EUR 187 |
 mStrawberry Rabbit Polyclonal Antibody |
|
38083-100ul |
SAB |
100ul |
EUR 252 |
|
mStrawberry Rabbit Polyclonal Antibody |
|
38083-50ul |
SAB |
50ul |
EUR 187 |
 AmCyan Rabbit Polyclonal Antibody |
|
38086-100ul |
SAB |
100ul |
EUR 252 |
|
AmCyan Rabbit Polyclonal Antibody |
|
38086-50ul |
SAB |
50ul |
EUR 187 |
 EBFP Rabbit Polyclonal Antibody |
|
38087-100ul |
SAB |
100ul |
EUR 252 |
|
EBFP Rabbit Polyclonal Antibody |
|
38087-50ul |
SAB |
50ul |
EUR 187 |
 Vimentin Rabbit Polyclonal Antibody |
|
38104-100ul |
SAB |
100ul |
EUR 252 |
|
Vimentin Rabbit Polyclonal Antibody |
|
38104-50ul |
SAB |
50ul |
EUR 187 |
 LDHD Rabbit Polyclonal Antibody |
|
38105-100ul |
SAB |
100ul |
EUR 252 |
|
LDHD Rabbit Polyclonal Antibody |
|
38105-50ul |
SAB |
50ul |
EUR 187 |
|
GAPDH Rabbit Polyclonal Antibody |
|
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
|
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
|
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
 Rabbit Hemoglobin Polyclonal Antibody |
|
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
|
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
|
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
 VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
|
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
|
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
 CD10 Rabbit Polyclonal Antibody |
|
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
|
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
|
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
 NM23A Rabbit Polyclonal Antibody |
|
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
|
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
|
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
RGS22 Rabbit Polyclonal Antibody
pECMV-Rgs22-m-FLAG Plasmid 