January 18, 2022

ULK4 Rabbit Polyclonal Antibody

ULK4 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

ULK4 Polyclonal Antibody

ES10217-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ULK4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

ULK4 Polyclonal Antibody

ES10217-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ULK4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

ULK4 Rabbit pAb

A7471-100ul 100 ul
EUR 308

ULK4 Rabbit pAb

A7471-200ul 200 ul
EUR 459

ULK4 Rabbit pAb

A7471-20ul 20 ul
EUR 183

ULK4 Rabbit pAb

A7471-50ul 50 ul
EUR 223

ULK4 Antibody

43614-100ul 100ul
EUR 252

ULK4 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against ULK4. Recognizes ULK4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

ULK4 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against ULK4. Recognizes ULK4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

ULK4 Antibody

DF9891 200ul
EUR 304
Description: ULK4 Antibody detects endogenous levels of total ULK4.

ULK4 Antibody

ABD9891 100 ug
EUR 438

Polyclonal ULK4 Antibody (C-Terminus)

AMM08433G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ULK4 (C-Terminus). This antibody is tested and proven to work in the following applications:

Serine/threonine-Protein Kinase ULK4 (ULK4) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serine/threonine-Protein Kinase ULK4 (ULK4) Antibody

abx122774-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Serine/threonine-Protein Kinase ULK4 (ULK4) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serine/threonine-Protein Kinase ULK4 (ULK4) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

ULK4 Conjugated Antibody

C43614 100ul
EUR 397

Anti-ULK4 antibody

STJ29607 100 µl
EUR 277
Description: This gene encodes a member of the unc-51-like serine/threonine kinase (STK) family. Members of this protein family play a role in neuronal growth and endocytosis. The encoded protein is likely involved in neurite branching, neurite elongation and neuronal migration. Genome-wide association studies (GWAS) indicate an association of variations in this gene with blood pressure and hypertension. Sequence variations in this gene may also be be associated with psychiatric disorders, including schizophrenia and bipolar disorder. Pseudogenes associated with this gene have been identified and are located on chromosome 15.

Anti-ULK4 antibody

STJ191375 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ULK4

Anti-ULK4 Antibody

STJ503470 100 µg
EUR 476


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA19493 50 ul
EUR 363
Description: Mouse polyclonal to ULK4


YF-PA19494 100 ug
EUR 403
Description: Rabbit polyclonal to ULK4

Anti-ULK4 Antibody (Biotin)

STJ503471 100 µg
EUR 586

Anti-ULK4 Antibody (FITC)

STJ503472 100 µg
EUR 586

ULK4 Blocking Peptide

DF9891-BP 1mg
EUR 195

ULK4 cloning plasmid

CSB-CL853394HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1743
  • Sequence: atggaaaactttattctgtatgaggagatcggaagaggaagcaagactgttgtctataaagggcgacggaagggaacaatcaattttgtagccattctttgtactgataagtgcaaaaggcctgaaataaccaactgggtccgtctcacccgtgaaataaaacacaagaatattg
  • Show more
Description: A cloning plasmid for the ULK4 gene.


PVT13821 2 ug
EUR 391

Mouse Serine/threonine- protein kinase ULK4, Ulk4 ELISA KIT

ELI-51201m 96 Tests
EUR 865

Human Serine/threonine- protein kinase ULK4, ULK4 ELISA KIT

ELI-44741h 96 Tests
EUR 824

Human ULK4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse ULK4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Anti-ULK4 (4A10-1A7)

YF-MA18713 100 ug
EUR 363
Description: Mouse monoclonal to ULK4

Ulk4 ORF Vector (Mouse) (pORF)

ORF061031 1.0 ug DNA
EUR 506

h ULK4 inducible lentiviral particles

LVP164 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, ULK4 , is fully sequence verified and matched to NCBI accession ID: NM_017886.2

ULK4 ORF Vector (Human) (pORF)

ORF011322 1.0 ug DNA
EUR 95

Monoclonal ULK4 Antibody (monoclonal) (M01), Clone: 4A10-1A7

AMM08434G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human ULK4 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 4A10-1A7. This antibody is applicable in WB, E

Ulk4 sgRNA CRISPR Lentivector set (Mouse)

K3603101 3 x 1.0 ug
EUR 339

ULK4 sgRNA CRISPR Lentivector set (Human)

K2587701 3 x 1.0 ug
EUR 339

ULK4-IT1 ORF Vector (Human) (pORF)

ORF035491 1.0 ug DNA Ask for price

Ulk4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3603102 1.0 ug DNA
EUR 154

Ulk4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3603103 1.0 ug DNA
EUR 154

Ulk4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3603104 1.0 ug DNA
EUR 154

ULK4 sgRNA CRISPR Lentivector (Human) (Target 1)

K2587702 1.0 ug DNA
EUR 154

ULK4 sgRNA CRISPR Lentivector (Human) (Target 2)

K2587703 1.0 ug DNA
EUR 154

ULK4 sgRNA CRISPR Lentivector (Human) (Target 3)

K2587704 1.0 ug DNA
EUR 154

ULK4 Protein Vector (Mouse) (pPB-C-His)

PV244122 500 ng
EUR 1065

ULK4 Protein Vector (Mouse) (pPB-N-His)

PV244123 500 ng
EUR 1065

ULK4 Protein Vector (Mouse) (pPM-C-HA)

PV244124 500 ng
EUR 1065

ULK4 Protein Vector (Mouse) (pPM-C-His)

PV244125 500 ng
EUR 1065

ULK4 Protein Vector (Human) (pPB-C-His)

PV045285 500 ng
EUR 329

ULK4 Protein Vector (Human) (pPB-N-His)

PV045286 500 ng
EUR 329

ULK4 Protein Vector (Human) (pPM-C-HA)

PV045287 500 ng
EUR 329

ULK4 Protein Vector (Human) (pPM-C-His)

PV045288 500 ng
EUR 329

Ulk4 3'UTR Luciferase Stable Cell Line

TU121577 1.0 ml Ask for price

ULK4 3'UTR GFP Stable Cell Line

TU077824 1.0 ml
EUR 1394

Ulk4 3'UTR GFP Stable Cell Line

TU171577 1.0 ml Ask for price

ULK4 3'UTR Luciferase Stable Cell Line

TU027824 1.0 ml
EUR 1394

ULK4-IT1 Protein Vector (Human) (pPB-C-His)

PV141962 500 ng Ask for price

ULK4-IT1 Protein Vector (Human) (pPB-N-His)

PV141963 500 ng Ask for price

ULK4-IT1 Protein Vector (Human) (pPM-C-HA)

PV141964 500 ng Ask for price

ULK4-IT1 Protein Vector (Human) (pPM-C-His)

PV141965 500 ng Ask for price

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

ULK4 Rabbit Polyclonal Antibody