October 23, 2021

RAB17 Rabbit Polyclonal Antibody

RAB17 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

RAB17 Polyclonal Antibody

ABP60059-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RAB17 protein at amino acid sequence of 50-130
  • Applications tips:
Description: A polyclonal antibody for detection of RAB17 from Human, Mouse. This RAB17 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB17 protein at amino acid sequence of 50-130

RAB17 Rabbit pAb

A7831-100ul 100 ul
EUR 308

RAB17 Rabbit pAb

A7831-200ul 200 ul
EUR 459

RAB17 Rabbit pAb

A7831-20ul 20 ul
EUR 183

RAB17 Rabbit pAb

A7831-50ul 50 ul
EUR 223

RAB17 Antibody

ABD9815 100 ug
EUR 438

RAB17 Antibody

ABD13222 100 ug
EUR 438

RAB17 Antibody

43393-100ul 100ul
EUR 252

RAB17 antibody

10R-5560 100 ul
EUR 726
Description: Mouse monoclonal RAB17 antibody

RAB17 antibody

10R-5561 100 ul
EUR 691
Description: Mouse monoclonal RAB17 antibody

RAB17 antibody

10R-5562 100 ul
EUR 691
Description: Mouse monoclonal RAB17 antibody

RAB17 Antibody

DF9815 200ul
EUR 304
Description: RAB17 Antibody detects endogenous levels of total RAB17.

RAB17 Antibody

1-CSB-PA578011
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAB17. Recognizes RAB17 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

RAB17 Antibody

1-CSB-PA239298
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAB17. Recognizes RAB17 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:30-1:150

RAB17 Antibody

1-CSB-PA863944ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RAB17. Recognizes RAB17 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

RAB17, Member RAS Oncogene Family (RAB17) Antibody

20-abx142182
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB17, Member RAS Oncogene Family (RAB17) Antibody

20-abx006549
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB17, Member RAS Oncogene Family (RAB17) Antibody

20-abx007326
  • EUR 411.00
  • EUR 592.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB17, Member RAS Oncogene Family (RAB17) Antibody

20-abx322467
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB17, Member RAS Oncogene Family (Rab17) Antibody

abx431544-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

RAB17, Member RAS Oncogene Family (RAB17) Antibody

abx236997-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

RAB17, Member RAS Oncogene Family (RAB17) Antibody

20-abx211887
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB17, Member RAS Oncogene Family (RAB17) Antibody

20-abx212777
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB17 Conjugated Antibody

C43393 100ul
EUR 397

anti- RAB17 antibody

FNab06997 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: RAB17, member RAS oncogene family
  • Uniprot ID: Q9H0T7
  • Gene ID: 64284
  • Research Area: Signal Transduction
Description: Antibody raised against RAB17

Mouse Rab17 Antibody

abx030499-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Mouse Rab17 Antibody

abx030499-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Human Rab17 Antibody

33102-05111 150 ug
EUR 261

Anti-RAB17 antibody

PAab06997 100 ug
EUR 355

Anti-RAB17 antibody

STJ110141 100 µl
EUR 277

Anti-RAB17 antibody

STJ191271 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RAB17

RAB17 siRNA

20-abx930605
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB17 siRNA

20-abx930606
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-RAB17

YF-PA20504 50 ul
EUR 363
Description: Mouse polyclonal to RAB17

anti-RAB17

YF-PA20505 100 ug
EUR 403
Description: Rabbit polyclonal to RAB17

Anti-Rab17 (mouse) antibody

STJ71451 100 µg
EUR 359

RAB17 cloning plasmid

CSB-CL863944HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 639
  • Sequence: atggcacaggcacacaggaccccccagcccagggctgcccccagccagccccgtgtgttcaagctggttctcctgggaagtggctccgtgggtaagtccagcttggctcttcggtacgtgaagaacgacttcaagagtatcctgcctacggtgggctgtgcgttcttcacaaaggt
  • Show more
Description: A cloning plasmid for the RAB17 gene.

RAB17 cloning plasmid

CSB-CL863944HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 258
  • Sequence: atgctggtgggcaacaagacggacctcagccaggagcgggaggtgaccttccaggaagggaaggagtttgccgacagccagaagttgctgttcatggaaacttcggccaaactgaaccaccaggtgtcggaggtgttcaatacagtggcccaagagctactgcagagaagcgacga
  • Show more
Description: A cloning plasmid for the RAB17 gene.

RAB17 Blocking Peptide

DF9815-BP 1mg
EUR 195

pCMV-SPORT6-RAB17

PVT19127 2 ug
EUR 231

Anti-Rab17 (2B7)

YF-MA19221 100 ug
EUR 363
Description: Mouse monoclonal to Rab17

Anti-RAB17 (2A10)

YF-MA11630 100 ug
EUR 363
Description: Mouse monoclonal to RAB17

Human Rab17 Antibody (Biotin Conjugate)

33102-05121 150 ug
EUR 369

RAB17 ELISA KIT|Human

EF002216 96 Tests
EUR 689

RAB17 protein (His tag)

80R-1867 100 ug
EUR 305
Description: Purified recombinant RAB17 protein

Mouse RAB17 shRNA Plasmid

20-abx972337
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RAB17 shRNA Plasmid

20-abx961976
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RAB17 Recombinant Protein (Human)

RP025423 100 ug Ask for price

RAB17 Recombinant Protein (Human)

RP025426 100 ug Ask for price

RAB17 Recombinant Protein (Rat)

RP223256 100 ug Ask for price

RAB17 Recombinant Protein (Mouse)

RP166202 100 ug Ask for price

RAB17 Recombinant Protein (Mouse)

RP166205 100 ug Ask for price

Human Rab17 AssayLite Antibody (FITC Conjugate)

33102-05141 150 ug
EUR 428

Human Rab17 AssayLite Antibody (RPE Conjugate)

33102-05151 150 ug
EUR 428

Human Rab17 AssayLite Antibody (APC Conjugate)

33102-05161 150 ug
EUR 428

Human Rab17 AssayLite Antibody (PerCP Conjugate)

33102-05171 150 ug
EUR 471

Monoclonal RAB17 Antibody (monoclonal) (M01), Clone: 2A10

AMM07446G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human RAB17 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2A10. This antibody is applicable in WB and IHC, E

Monoclonal RAB17 Antibody (monoclonal) (M05), Clone: 2B7

AMM07447G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human RAB17 (monoclonal) (M05). The antibodies are raised in mouse and are from clone 2B7. This antibody is applicable in WB, E

RAB17 ORF Vector (Human) (pORF)

ORF008475 1.0 ug DNA
EUR 95

RAB17 ORF Vector (Human) (pORF)

ORF008476 1.0 ug DNA
EUR 95

Rab17 ORF Vector (Rat) (pORF)

ORF074420 1.0 ug DNA
EUR 506

Rab17 ORF Vector (Mouse) (pORF)

ORF055402 1.0 ug DNA
EUR 506

Rab17 ORF Vector (Mouse) (pORF)

ORF055403 1.0 ug DNA
EUR 506

RAB17, Member RAS Oncogene Family Protein

20-abx261460
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

RAB17 sgRNA CRISPR Lentivector set (Human)

K1772001 3 x 1.0 ug
EUR 339

Rab17 sgRNA CRISPR Lentivector set (Mouse)

K3792001 3 x 1.0 ug
EUR 339

Rab17 sgRNA CRISPR Lentivector set (Rat)

K6548001 3 x 1.0 ug
EUR 339

Recombinant Human RAB17, Member RAS Oncogene Family

7-06016 5µg Ask for price

Recombinant Human RAB17, Member RAS Oncogene Family

7-06017 20µg Ask for price

Recombinant Human RAB17, Member RAS Oncogene Family

7-06018 1mg Ask for price

RAB17 sgRNA CRISPR Lentivector (Human) (Target 1)

K1772002 1.0 ug DNA
EUR 154

RAB17 Rabbit Polyclonal Antibody