October 26, 2021

PGK2 Rabbit Polyclonal Antibody

PGK2 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

PGK2 Polyclonal Antibody

ES9999-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PGK2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PGK2 Polyclonal Antibody

ES9999-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PGK2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PGK2 Rabbit pAb

A12952-100ul 100 ul
EUR 308

PGK2 Rabbit pAb

A12952-200ul 200 ul
EUR 459

PGK2 Rabbit pAb

A12952-20ul 20 ul
EUR 183

PGK2 Rabbit pAb

A12952-50ul 50 ul
EUR 223

PGK2 Rabbit pAb

A4017-100ul 100 ul
EUR 308

PGK2 Rabbit pAb

A4017-200ul 200 ul
EUR 459

PGK2 Rabbit pAb

A4017-20ul 20 ul Ask for price

PGK2 Rabbit pAb

A4017-50ul 50 ul Ask for price

PGK2 antibody

70R-19242 50 ul
EUR 435
Description: Rabbit polyclonal PGK2 antibody

PGK2 antibody

70R-2323 50 ug
EUR 467
Description: Rabbit polyclonal PGK2 antibody raised against the C terminal of PGK2

PGK2 Antibody

36193-100ul 100ul
EUR 252

PGK2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PGK2. Recognizes PGK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:50-1:200

PGK2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PGK2. Recognizes PGK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

PGK2 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PGK2. Recognizes PGK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000

PGK2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PGK2. Recognizes PGK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:50-1:200

Polyclonal PGK2 Antibody (N-term)

APR09089G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PGK2 (N-term). This antibody is tested and proven to work in the following applications:

PGK2 Polyclonal Antibody, Biotin Conjugated

A60251 100 µg
EUR 570.55
Description: Ask the seller for details

PGK2 Polyclonal Antibody, FITC Conjugated

A60252 100 µg
EUR 570.55
Description: The best epigenetics products

PGK2 Polyclonal Antibody, HRP Conjugated

A60253 100 µg
EUR 570.55
Description: kits suitable for this type of research

Human PGK2 Antibody

32645-05111 150 ug
EUR 261

PGK2 Conjugated Antibody

C36193 100ul
EUR 397

anti- PGK2 antibody

FNab06355 100µg
EUR 548.75
  • Immunogen: phosphoglycerate kinase 2
  • Uniprot ID: P07205
  • Gene ID: 5232
  • Research Area: Metabolism
Description: Antibody raised against PGK2

Anti-PGK2 antibody

PAab06355 100 ug
EUR 386

Anti-PGK2 antibody

STJ26532 100 µl
EUR 277
Description: This gene is intronless, arose via retrotransposition of the phosphoglycerate kinase 1 gene, and is expressed specifically in the testis. Initially assumed to be a pseudogene, the encoded protein is actually a functional phosphoglycerate kinase that catalyzes the reversible conversion of 1,3-bisphosphoglycerate to 3-phosphoglycerate, during the Embden-Meyerhof-Parnas pathway of glycolysis, in the later stages of spermatogenesis.

Anti-PGK2 antibody

STJ114818 100 µl
EUR 277
Description: This gene is intronless, arose via retrotransposition of the phosphoglycerate kinase 1 gene, and is expressed specifically in the testis. Initially assumed to be a pseudogene, the encoded protein is actually a functional phosphoglycerate kinase that catalyzes the reversible conversion of 1,3-bisphosphoglycerate to 3-phosphoglycerate, during the Embden-Meyerhof-Parnas pathway of glycolysis, in the later stages of spermatogenesis.

Anti-PGK2 antibody

STJ191157 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PGK2


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA24360 50 ul
EUR 334
Description: Mouse polyclonal to PGK2

PGK2 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PGK2. Recognizes PGK2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PGK2 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PGK2. Recognizes PGK2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PGK2 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PGK2. Recognizes PGK2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Rabbit Phosphoglycee kinase 2(PGK2) ELISA kit

E04P0843-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Phosphoglycee kinase 2(PGK2) ELISA kit

E04P0843-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Phosphoglycee kinase 2(PGK2) ELISA kit

E04P0843-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

PGK2 Blocking Peptide

33R-4189 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PGK2 antibody, catalog no. 70R-2323

PGK2, human recombinant

EUR 501

PGK2 cloning plasmid

CSB-CL017859HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1254
  • Sequence: atgtctctttctaagaagttgactttagacaaactggatgttagagggaagcgagtcatcatgagagtagacttcaatgttcccatgaagaagaaccagattacaaacaaccagaggatcaaggcttccatcccaagcatcaagtactgcctggacaatggagccaaggcagtag
  • Show more
Description: A cloning plasmid for the PGK2 gene.

Human PGK2 Antibody (Biotin Conjugate)

32645-05121 150 ug
EUR 369

Phosphoglycerate Kinase 2 (PGK2) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Phosphoglycerate Kinase 2 (PGK2) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Phosphoglycerate Kinase 2 (PGK2) Antibody

abx146476-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Phosphoglycerate Kinase 2 (PGK2) Antibody

abx033208-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Phosphoglycerate Kinase 2 (PGK2) Antibody

abx033208-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Phosphoglycerate Kinase 2 (PGK2) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Phosphoglycerate Kinase 2 (PGK2) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Phosphoglycerate Kinase 2 (PGK2) Antibody

abx236355-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Phosphoglycerate Kinase 2 (PGK2) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human PGK2 AssayLite Antibody (FITC Conjugate)

32645-05141 150 ug
EUR 428

Human PGK2 AssayLite Antibody (RPE Conjugate)

32645-05151 150 ug
EUR 428

Human PGK2 AssayLite Antibody (APC Conjugate)

32645-05161 150 ug
EUR 428

Human PGK2 AssayLite Antibody (PerCP Conjugate)

32645-05171 150 ug
EUR 471

Phosphoglycerate Kinase 2 (PGK2) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphoglycerate Kinase 2 (PGK2) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphoglycerate Kinase 2 (PGK2) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

PGK2 protein (His tag)

80R-2091 50 ug
EUR 424
Description: Recombinant human PGK2 protein (His tag)


EF001709 96 Tests
EUR 689

Mouse PGK2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PGK2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PGK2 Recombinant Protein (Human)

RP023230 100 ug Ask for price

PGK2 Recombinant Protein (Mouse)

RP161579 100 ug Ask for price

PGK2 Recombinant Protein (Rat)

RP220214 100 ug Ask for price

Pgk2 ORF Vector (Rat) (pORF)

ORF073406 1.0 ug DNA
EUR 506

PGK2 ORF Vector (Human) (pORF)

ORF007744 1.0 ug DNA
EUR 95

Pgk2 ORF Vector (Mouse) (pORF)

ORF053861 1.0 ug DNA
EUR 506

Pgk2 sgRNA CRISPR Lentivector set (Rat)

K6046401 3 x 1.0 ug
EUR 339

Pgk2 sgRNA CRISPR Lentivector set (Mouse)

K3822201 3 x 1.0 ug
EUR 339

PGK2 sgRNA CRISPR Lentivector set (Human)

K1635001 3 x 1.0 ug
EUR 339

Rat Phosphoglycee kinase 2(PGK2) ELISA kit

E02P0843-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Phosphoglycee kinase 2(PGK2) ELISA kit

E02P0843-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Phosphoglycee kinase 2(PGK2) ELISA kit

E02P0843-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Phosphoglycee kinase 2(PGK2) ELISA kit

E03P0843-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Phosphoglycee kinase 2(PGK2) ELISA kit

E03P0843-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Phosphoglycee kinase 2(PGK2) ELISA kit

E03P0843-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phosphoglycee kinase 2(PGK2) ELISA kit

E01P0843-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phosphoglycee kinase 2(PGK2) ELISA kit

E01P0843-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phosphoglycee kinase 2(PGK2) ELISA kit

E01P0843-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Phosphoglycee kinase 2(PGK2) ELISA kit

E06P0843-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Phosphoglycee kinase 2(PGK2) ELISA kit

E06P0843-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Phosphoglycee kinase 2(PGK2) ELISA kit

E06P0843-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Phosphoglycee kinase 2(PGK2) ELISA kit

E08P0843-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Phosphoglycee kinase 2(PGK2) ELISA kit

E08P0843-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Phosphoglycee kinase 2(PGK2) ELISA kit

E08P0843-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Phosphoglycee kinase 2(PGK2) ELISA kit

E07P0843-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Phosphoglycee kinase 2(PGK2) ELISA kit

E07P0843-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Phosphoglycee kinase 2(PGK2) ELISA kit

E07P0843-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Phosphoglycee kinase 2(PGK2) ELISA kit

E09P0843-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Phosphoglycee kinase 2(PGK2) ELISA kit

E09P0843-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Phosphoglycee kinase 2(PGK2) ELISA kit

E09P0843-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Phosphoglycerate kinase 2, Pgk2 ELISA KIT

ELI-15273m 96 Tests
EUR 865

Porcine Phosphoglycerate kinase 2, PGK2 ELISA KIT

ELI-20972p 96 Tests
EUR 928

Human Phosphoglycerate kinase 2, PGK2 ELISA KIT

ELI-22705h 96 Tests
EUR 824

Human Phosphoglycerate Kinase 2 (PGK2) ELISA Kit

abx382179-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Pgk2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6046402 1.0 ug DNA
EUR 154

Pgk2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6046403 1.0 ug DNA
EUR 154

Pgk2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6046404 1.0 ug DNA
EUR 154

Pgk2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3822202 1.0 ug DNA
EUR 154

Pgk2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3822203 1.0 ug DNA
EUR 154

Pgk2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3822204 1.0 ug DNA
EUR 154

PGK2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1635002 1.0 ug DNA
EUR 154

PGK2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1635003 1.0 ug DNA
EUR 154

PGK2 sgRNA CRISPR Lentivector (Human) (Target 3)

K1635004 1.0 ug DNA
EUR 154

PGK2 Phosphoglycerate Kinase 2 Human Recombinant Protein

PROTP07205 Regular: 10ug
EUR 317
Description: PGK2 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 437 amino acids (1-417 a.a.) and having a molecular mass of 46.9kDa.;PGK2 is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

PGK2 Protein Vector (Rat) (pPB-C-His)

PV293622 500 ng
EUR 603

PGK2 Protein Vector (Rat) (pPB-N-His)

PV293623 500 ng
EUR 603

PGK2 Protein Vector (Rat) (pPM-C-HA)

PV293624 500 ng
EUR 603

PGK2 Protein Vector (Rat) (pPM-C-His)

PV293625 500 ng
EUR 603

PGK2 Protein Vector (Human) (pPB-C-His)

PV030973 500 ng
EUR 329

PGK2 Protein Vector (Human) (pPB-N-His)

PV030974 500 ng
EUR 329

PGK2 Protein Vector (Human) (pPM-C-HA)

PV030975 500 ng
EUR 329

PGK2 Protein Vector (Human) (pPM-C-His)

PV030976 500 ng
EUR 329

PGK2 Protein Vector (Mouse) (pPB-C-His)

PV215442 500 ng
EUR 603

PGK2 Protein Vector (Mouse) (pPB-N-His)

PV215443 500 ng
EUR 603

PGK2 Protein Vector (Mouse) (pPM-C-HA)

PV215444 500 ng
EUR 603

PGK2 Protein Vector (Mouse) (pPM-C-His)

PV215445 500 ng
EUR 603

Recombinant Human PGK2 Protein, His, E.coli-10ug

QP13031-10ug 10ug
EUR 201

Recombinant Human PGK2 Protein, His, E.coli-1mg

QP13031-1mg 1mg
EUR 5251

Recombinant Human PGK2 Protein, His, E.coli-2ug

QP13031-2ug 2ug
EUR 155

Pgk2 3'UTR Luciferase Stable Cell Line

TU116251 1.0 ml Ask for price

Pgk2 3'UTR GFP Stable Cell Line

TU166251 1.0 ml Ask for price

Pgk2 3'UTR Luciferase Stable Cell Line

TU216133 1.0 ml Ask for price

Pgk2 3'UTR GFP Stable Cell Line

TU266133 1.0 ml Ask for price

PGK2 3'UTR GFP Stable Cell Line

TU067807 1.0 ml
EUR 2333

PGK2 3'UTR Luciferase Stable Cell Line

TU017807 1.0 ml
EUR 2333

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

PGK2 Rabbit Polyclonal Antibody