October 28, 2021

NBPF3 Rabbit Polyclonal Antibody

NBPF3 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

NBPF3 Polyclonal Antibody
ES9901-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBPF3 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
NBPF3 Polyclonal Antibody
ABP59406-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human NBPF3 protein at amino acid sequence of 410-490
  • Applications tips:
Description: A polyclonal antibody for detection of NBPF3 from Human. This NBPF3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NBPF3 protein at amino acid sequence of 410-490
NBPF3 Polyclonal Antibody
ABP59406-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human NBPF3 protein at amino acid sequence of 410-490
  • Applications tips:
Description: A polyclonal antibody for detection of NBPF3 from Human. This NBPF3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NBPF3 protein at amino acid sequence of 410-490
NBPF3 Polyclonal Antibody
ABP59406-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NBPF3 protein at amino acid sequence of 410-490
  • Applications tips:
Description: A polyclonal antibody for detection of NBPF3 from Human. This NBPF3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NBPF3 protein at amino acid sequence of 410-490
NBPF3 Polyclonal Antibody
A67478 100 µg
EUR 570.55
Description: The best epigenetics products
NBPF3 Antibody
abx146004-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
NBPF3 Antibody
ABD9684 100 ug
EUR 438
NBPF3 Antibody
46081-100ul 100ul
EUR 252
NBPF3 Antibody
46081-50ul 50ul
EUR 187
NBPF3 Antibody
DF9684 200ul
EUR 304
Description: NBPF3 Antibody detects endogenous levels of total NBPF3.
NBPF3 Antibody
1-CSB-PA872422LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against NBPF3. Recognizes NBPF3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200
NBPF3 Polyclonal Antibody, HRP Conjugated
A67479 100 µg
EUR 570.55
Description: kits suitable for this type of research
NBPF3 Polyclonal Antibody, FITC Conjugated
A67480 100 µg
EUR 570.55
Description: fast delivery possible
NBPF3 Polyclonal Antibody, Biotin Conjugated
A67481 100 µg
EUR 570.55
Description: reagents widely cited
NBPF3 Conjugated Antibody
C46081 100ul
EUR 397
NBPF3 Antibody (HRP)
20-abx311149
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
NBPF3 Antibody (FITC)
20-abx311150
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
NBPF3 Antibody (Biotin)
20-abx311151
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Anti-NBPF3 antibody
STJ191059 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NBPF3
NBPF3 siRNA
20-abx925461
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
pBlueScriptR-NBPF3
PVT17368 2 ug
EUR 231
NBPF3 Antibody, HRP conjugated
1-CSB-PA872422LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against NBPF3. Recognizes NBPF3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
NBPF3 Antibody, FITC conjugated
1-CSB-PA872422LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against NBPF3. Recognizes NBPF3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
NBPF3 Antibody, Biotin conjugated
1-CSB-PA872422LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against NBPF3. Recognizes NBPF3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
NBPF3 cloning plasmid
CSB-CL872422HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1017
  • Sequence: atgccactgactcccactgtccagggcttccagtggactctccgaggccctgatgtagaaacttccccattcggtgcaccaagagcagcctcacatggtgtgggccgacatcaagagctgcgagatccaacagtccctggccccacctcttctgccacaaacgtcagcatggtgg
  • Show more
Description: A cloning plasmid for the NBPF3 gene.
NBPF3 Blocking Peptide
DF9684-BP 1mg
EUR 195
Human NBPF3 shRNA Plasmid
20-abx963360
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
NBPF3 Recombinant Protein (Human)
RP020770 100 ug Ask for price
NBPF3 ORF Vector (Human) (pORF)
ORF006924 1.0 ug DNA
EUR 95
Neuroblastoma Breakpoint Family Member 3 (NBPF3) Antibody
20-abx311148
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Neuroblastoma Breakpoint Family Member 3 (NBPF3) Antibody
20-abx217125
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

NBPF3 Rabbit Polyclonal Antibody