January 17, 2022

BTF3 Rabbit Polyclonal Antibody

BTF3 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

BTF3 Polyclonal Antibody

ABP57929-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human BTF3 protein at amino acid sequence of 120-200
  • Applications tips:
Description: A polyclonal antibody for detection of BTF3 from Human, Mouse. This BTF3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BTF3 protein at amino acid sequence of 120-200

BTF3 Polyclonal Antibody

ABP57929-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human BTF3 protein at amino acid sequence of 120-200
  • Applications tips:
Description: A polyclonal antibody for detection of BTF3 from Human, Mouse. This BTF3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BTF3 protein at amino acid sequence of 120-200

BTF3 Polyclonal Antibody

ES10374-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against BTF3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

BTF3 Polyclonal Antibody

ES10374-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against BTF3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

BTF3 Rabbit pAb

A15259-100ul 100 ul
EUR 308

BTF3 Rabbit pAb

A15259-200ul 200 ul
EUR 459

BTF3 Rabbit pAb

A15259-20ul 20 ul
EUR 183

BTF3 Rabbit pAb

A15259-50ul 50 ul
EUR 223

BTF3 Polyclonal Conjugated Antibody

C28890 100ul
EUR 397

Transcription Factor BTF3 (BTF3) Antibody

abx026082-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Transcription Factor BTF3 (BTF3) Antibody

abx026082-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Transcription Factor BTF3 (BTF3) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

BTF3 antibody

20R-1189 100 ug
EUR 377
Description: Rabbit polyclonal BTF3 antibody

BTF3 antibody

70R-15362 100 ug
EUR 327
Description: Rabbit polyclonal BTF3 antibody

BTF3 antibody

10R-1391 100 ug
EUR 512
Description: Mouse monoclonal BTF3 antibody

BTF3 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BTF3. Recognizes BTF3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

BTF3 Polyclonal Antibody, HRP Conjugated

A51858 100 µg
EUR 570.55
Description: reagents widely cited

BTF3 Polyclonal Antibody, FITC Conjugated

A51859 100 µg
EUR 570.55
Description: Ask the seller for details

BTF3 Polyclonal Antibody, Biotin Conjugated

A51860 100 µg
EUR 570.55
Description: The best epigenetics products

Transcription Factor BTF3 (BTF3) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Transcription Factor BTF3 (BTF3) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Transcription Factor BTF3 (BTF3) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Transcription Factor BTF3 (BTF3) Antibody Pair

abx117418-1pair5x96wellplates 1 pair (5x96 well plates)
EUR 1010
  • Shipped within 5-10 working days.

BTF3 antibody (HRP)

60R-1900 100 ug
EUR 327
Description: Rabbit polyclonal BTF3 antibody (HRP)

BTF3 antibody (FITC)

60R-1901 100 ug
EUR 327
Description: Rabbit polyclonal BTF3 antibody (FITC)

BTF3 antibody (biotin)

60R-1902 100 ug
EUR 327
Description: Rabbit polyclonal BTF3 antibody (biotin)

Anti-BTF3 antibody

STJ117454 100 µl
EUR 277
Description: This gene encodes the basic transcription factor 3. This protein forms a stable complex with RNA polymerase IIB and is required for transcriptional initiation. Alternative splicing results in multiple transcript variants encoding different isoforms. This gene has multiple pseudogenes.

Anti-BTF3 antibody

STJ191532 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to BTF3

Human Transcription factor BTF3 (BTF3)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 44.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Transcription factor BTF3(BTF3),partial expressed in E.coli

Transcription Factor BTF3 (BTF3) Protein

  • EUR 1609.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 10 ug
  • 2 µg
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

BTF3 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BTF3. Recognizes BTF3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

BTF3 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BTF3. Recognizes BTF3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

BTF3 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BTF3. Recognizes BTF3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human Transcription factor BTF3, BTF3 ELISA KIT

ELI-25124h 96 Tests
EUR 824

Mouse Transcription factor BTF3, Btf3 ELISA KIT

ELI-25125m 96 Tests
EUR 865

Human Transcription Factor BTF3 (BTF3) ELISA Kit

abx384619-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Transcription Factor BTF3 (BTF3) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Mouse Transcription Factor BTF3 (BTF3) ELISA Kit

abx388654-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

BTF3 Blocking Peptide

33R-2169 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of BTF3 antibody, catalog no. 20R-1189

BTF3 cloning plasmid

CSB-CL002855HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 489
  • Sequence: atgaaagaaacaatcatgaaccaggaaaaactcgccaaactgcaggcacaagtgcgcattggtgggaaaggaactgctcgcagaaagaagaaggtggttcatagaacagccacagcagatgacaaaaaacttcagttctccttaaagaagttaggggtaaacaatatctctggtat
  • Show more
Description: A cloning plasmid for the BTF3 gene.

Btf3 ELISA Kit| Mouse Transcription factor BTF3 ELISA Kit

EF014279 96 Tests
EUR 689

BTF3 protein (His tag)

30R-2934 20 ug
EUR 322
Description: Purified recombinant Human BTF3 protein (His tag)


EF004652 96 Tests
EUR 689

Mouse BTF3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human BTF3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

BTF3 Recombinant Protein (Human)

RP003259 100 ug Ask for price

BTF3 Recombinant Protein (Human)

RP003262 100 ug Ask for price

BTF3 Recombinant Protein (Rat)

RP192533 100 ug Ask for price

BTF3 Recombinant Protein (Mouse)

RP120080 100 ug Ask for price

BTF3 Recombinant Protein (Mouse)

RP120083 100 ug Ask for price

Anti-BTF3 (3C4-2E11)

YF-MA12198 100 ug
EUR 363
Description: Mouse monoclonal to BTF3

Rabbit Transcription factor BTF3 homolog 4(BTF3L4) ELISA kit

E04T0602-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Transcription factor BTF3 homolog 4(BTF3L4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Transcription factor BTF3 homolog 4(BTF3L4) ELISA kit

E04T0602-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Transcription factor BTF3 homolog 4(BTF3L4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Transcription factor BTF3 homolog 4(BTF3L4) ELISA kit

E04T0602-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Transcription factor BTF3 homolog 4(BTF3L4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Transcription Factor BTF3 Homolog 4 (BTF3L4) Antibody

abx027527-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Transcription Factor BTF3 Homolog 4 (BTF3L4) Antibody

abx027527-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Transcription Factor BTF3 Homolog 4 (BTF3L4) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Transcription Factor BTF3 Homolog 4 (BTF3L4) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Transcription Factor BTF3 Homolog 4 (BTF3L4) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Btf3 ORF Vector (Rat) (pORF)

ORF064179 1.0 ug DNA
EUR 506

BTF3 ORF Vector (Human) (pORF)

ORF001087 1.0 ug DNA
EUR 95

BTF3 ORF Vector (Human) (pORF)

ORF001088 1.0 ug DNA
EUR 95

Btf3 ORF Vector (Mouse) (pORF)

ORF040028 1.0 ug DNA
EUR 506

Btf3 ORF Vector (Mouse) (pORF)

ORF040029 1.0 ug DNA
EUR 506

Btf3 sgRNA CRISPR Lentivector set (Mouse)

K4941901 3 x 1.0 ug
EUR 339

Btf3 sgRNA CRISPR Lentivector set (Rat)

K7460101 3 x 1.0 ug
EUR 339

BTF3 sgRNA CRISPR Lentivector set (Human)

K0199901 3 x 1.0 ug
EUR 339

Btf3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4941902 1.0 ug DNA
EUR 154

Btf3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4941903 1.0 ug DNA
EUR 154

Btf3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4941904 1.0 ug DNA
EUR 154

Btf3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7460102 1.0 ug DNA
EUR 154

Btf3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7460103 1.0 ug DNA
EUR 154

Btf3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7460104 1.0 ug DNA
EUR 154

BTF3 sgRNA CRISPR Lentivector (Human) (Target 1)

K0199902 1.0 ug DNA
EUR 154

BTF3 sgRNA CRISPR Lentivector (Human) (Target 2)

K0199903 1.0 ug DNA
EUR 154

BTF3 sgRNA CRISPR Lentivector (Human) (Target 3)

K0199904 1.0 ug DNA
EUR 154

BTF3 Protein Vector (Mouse) (pPB-C-His)

PV160110 500 ng
EUR 603

BTF3 Protein Vector (Mouse) (pPB-N-His)

PV160111 500 ng
EUR 603

BTF3 Protein Vector (Mouse) (pPM-C-HA)

PV160112 500 ng
EUR 603

BTF3 Protein Vector (Mouse) (pPM-C-His)

PV160113 500 ng
EUR 603

BTF3 Protein Vector (Mouse) (pPB-C-His)

PV160114 500 ng
EUR 603

BTF3 Protein Vector (Mouse) (pPB-N-His)

PV160115 500 ng
EUR 603

BTF3 Protein Vector (Mouse) (pPM-C-HA)

PV160116 500 ng
EUR 603

BTF3 Protein Vector (Mouse) (pPM-C-His)

PV160117 500 ng
EUR 603

BTF3 Protein Vector (Rat) (pPB-C-His)

PV256714 500 ng
EUR 603

BTF3 Protein Vector (Rat) (pPB-N-His)

PV256715 500 ng
EUR 603

BTF3 Protein Vector (Rat) (pPM-C-HA)

PV256716 500 ng
EUR 603

BTF3 Protein Vector (Rat) (pPM-C-His)

PV256717 500 ng
EUR 603

BTF3 Protein Vector (Human) (pPB-His-MBP)

PV327754 500 ng
EUR 329

BTF3 Protein Vector (Human) (pPB-His-GST)

PV327755 500 ng
EUR 329

BTF3 Protein Vector (Human) (pPB-His-MBP)

PV327758 500 ng
EUR 329

BTF3 Protein Vector (Human) (pPB-His-GST)

PV327759 500 ng
EUR 329

BTF3 Protein Vector (Human) (pPB-C-His)

PV004345 500 ng
EUR 329

BTF3 Protein Vector (Human) (pPB-N-His)

PV004346 500 ng
EUR 329

BTF3 Rabbit Polyclonal Antibody