October 23, 2021

TRPV6 Rabbit Polyclonal Antibody

TRPV6 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

TRPV6 Polyclonal Antibody
ES10391-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TRPV6 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
TRPV6 Polyclonal Antibody
ES10391-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TRPV6 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
TRPV6 Polyclonal Antibody
ABP60773-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human TRPV6 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TRPV6 from Human, Mouse, Rat. This TRPV6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TRPV6 protein
TRPV6 Polyclonal Antibody
ABP60773-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human TRPV6 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TRPV6 from Human, Mouse, Rat. This TRPV6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TRPV6 protein
TRPV6 Polyclonal Antibody
ABP60773-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human TRPV6 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TRPV6 from Human, Mouse, Rat. This TRPV6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TRPV6 protein
TRPV6 Polyclonal Antibody
A70187 100 ?g
EUR 628.55
Description: reagents widely cited
TRPV6 Rabbit pAb
A16128-100ul 100 ul
EUR 308
TRPV6 Rabbit pAb
A16128-200ul 200 ul
EUR 459
TRPV6 Rabbit pAb
A16128-20ul 20 ul
EUR 183
TRPV6 Rabbit pAb
A16128-50ul 50 ul
EUR 223
TRPV6 Rabbit pAb
A1495-100ul 100 ul
EUR 308
TRPV6 Rabbit pAb
A1495-200ul 200 ul
EUR 459
TRPV6 Rabbit pAb
A1495-20ul 20 ul Ask for price
TRPV6 Rabbit pAb
A1495-50ul 50 ul Ask for price
Polyclonal TRPV6 Antibody (Center)
APR10546G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRPV6 (Center). This antibody is tested and proven to work in the following applications:
TRPV6 antibody
70R-21017 50 ul
EUR 435
Description: Rabbit polyclonal TRPV6 antibody
Trpv6 antibody
70R-8072 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Trpv6 antibody
TRPV6 Antibody
39563-100ul 100ul
EUR 390
TRPV6 Antibody
43287-100ul 100ul
EUR 252
TRPV6 Antibody
DF12784 200ul
EUR 304
Description: TRPV6 Antibody detects endogenous levels of TRPV6.
TRPV6 Antibody
1-CSB-PA861992LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRPV6. Recognizes TRPV6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500
TRPV6 Antibody
1-CSB-PA025098GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TRPV6. Recognizes TRPV6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF
TRPV6 Polyclonal Antibody, HRP Conjugated
A70188 100 ?g
EUR 628.55
Description: Ask the seller for details
TRPV6 Polyclonal Antibody, FITC Conjugated
A70189 100 ?g
EUR 628.55
Description: The best epigenetics products
TRPV6 Polyclonal Antibody, Biotin Conjugated
A70190 100 ?g
EUR 628.55
Description: kits suitable for this type of research
TRPV6 Conjugated Antibody
C43287 100ul
EUR 397
anti- TRPV6 antibody
FNab09030 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:5000
  • IP: 1:200-1:1000
  • IF: 1:10-1:100
  • Immunogen: transient receptor potential cation channel, subfamily V, member 6
  • Uniprot ID: Q9H1D0
  • Gene ID: 55503
  • Research Area: Cancer
Description: Antibody raised against TRPV6
Anti-TRPV6 antibody
PAab09030 100 ug
EUR 386
Anti-TRPV6 Antibody
PA1980 100ug/vial
EUR 294
Anti-TRPV6 Antibody
STJ503414 100 µg
EUR 476
Anti-TRPV6 antibody
STJ25977 100 µl
EUR 277
Description: This gene encodes a member of a family of multipass membrane proteins that functions as calcium channels. The encoded protein contains N-terminal ankyrin repeats, which are required for channel assembly and regulation. Translation initiation for this protein occurs at a non-AUG start codon that is decoded as methionine. This gene is situated next to a closely related gene for transient receptor potential cation channel subfamily V member 5 (TRPV5). This locus has experienced positive selection in non-African populations, resulting in several non-synonymous codon differences among individuals of different genetic backgrounds.
Anti-TRPV6 antibody
STJ118581 100 µl
EUR 277
Anti-TRPV6 antibody
STJ191549 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TRPV6
Trpv6/ Rat Trpv6 ELISA Kit
ELI-51853r 96 Tests
EUR 886
TRPV6 siRNA
20-abx905818
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TRPV6 siRNA
20-abx938250
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TRPV6 siRNA
20-abx938251
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TRPV6 Antibody, HRP conjugated
1-CSB-PA861992LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRPV6. Recognizes TRPV6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
TRPV6 Antibody, FITC conjugated
1-CSB-PA861992LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRPV6. Recognizes TRPV6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
TRPV6 Antibody, Biotin conjugated
1-CSB-PA861992LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRPV6. Recognizes TRPV6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Anti-TRPV6 Antibody BIOTIN
STJ503415 100 µg
EUR 586
Anti-TRPV6 Antibody FITC
STJ503416 100 µg
EUR 586
Trpv6 Blocking Peptide
33R-9040 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Trpv6 antibody, catalog no. 70R-8072
TRPV6 cloning plasmid
CSB-CL861992HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 321
  • Sequence: atgtacgttgagaatcactgctccaggcctgcattactccttcagctctggggcagaggaagcccagcccaagcacggggctggcagggcgtgaggaactctcctgtggcctgctcatcacccttccgacaggagcactgcatgtcagagcactttaaaaacaggccagcctgctt
  • Show more
Description: A cloning plasmid for the TRPV6 gene.
TRPV6 Blocking Peptide
DF12784-BP 1mg
EUR 195
pDONR223-TRPV6 Plasmid
PVTB00947-1 2 ug
EUR 356
Mouse TRPV6 shRNA Plasmid
20-abx975264
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat TRPV6 shRNA Plasmid
20-abx987187
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TRPV6 ELISA KIT|Human
EF003875 96 Tests
EUR 689
Mouse Trpv6 ELISA KIT
ELI-40180m 96 Tests
EUR 865
Human TRPV6 ELISA KIT
ELI-51649h 96 Tests
EUR 824
Human TRPV6 shRNA Plasmid
20-abx960711
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TRPV6 Recombinant Protein (Human)
RP033088 100 ug Ask for price
TRPV6 Recombinant Protein (Rat)
RP234905 100 ug Ask for price
TRPV6 Recombinant Protein (Mouse)
RP181610 100 ug Ask for price
pCMV-SPORT6-TRPV6 Plasmid
PVT16506 2 ug
EUR 325
Trpv6 ORF Vector (Rat) (pORF)
ORF078303 1.0 ug DNA
EUR 506
TRPV6 ORF Vector (Human) (pORF)
ORF011030 1.0 ug DNA
EUR 95
Trpv6 ORF Vector (Mouse) (pORF)
ORF060538 1.0 ug DNA
EUR 506
TRPV6 ELISA Kit (Human) (OKCA02023)
OKCA02023 96 Wells
EUR 833
Description: Description of target: Calcium selective cation channel that mediates Ca2+ uptake in various tissues, including the intestine. Important for normal Ca2+ ion homeostasis in the body, including bone and skin.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 5.86 pg/mL
TRPV6 sgRNA CRISPR Lentivector set (Human)
K2537401 3 x 1.0 ug
EUR 339
Trpv6 sgRNA CRISPR Lentivector set (Mouse)
K4389801 3 x 1.0 ug
EUR 339
Trpv6 sgRNA CRISPR Lentivector set (Rat)
K7116701 3 x 1.0 ug
EUR 339
Transient Receptor Potential Cation Channel Subfamily V, Member 6 (TRPV6) Polyclonal Antibody (Human)
4-PAF851Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRPV6 (Met578~Ile725)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Transient Receptor Potential Cation Channel Subfamily V, Member 6 (TRPV6)
Transient Receptor Potential Cation Channel Subfamily V, Member 6 (TRPV6) Polyclonal Antibody (Human), APC
4-PAF851Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRPV6 (Met578~Ile725)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Transient Receptor Potential Cation Channel Subfamily V, Member 6 (TRPV6). This antibody is labeled with APC.
Transient Receptor Potential Cation Channel Subfamily V, Member 6 (TRPV6) Polyclonal Antibody (Human), Biotinylated
4-PAF851Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRPV6 (Met578~Ile725)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Transient Receptor Potential Cation Channel Subfamily V, Member 6 (TRPV6). This antibody is labeled with Biotin.
Transient Receptor Potential Cation Channel Subfamily V, Member 6 (TRPV6) Polyclonal Antibody (Human), Cy3
4-PAF851Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRPV6 (Met578~Ile725)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Transient Receptor Potential Cation Channel Subfamily V, Member 6 (TRPV6). This antibody is labeled with Cy3.
Transient Receptor Potential Cation Channel Subfamily V, Member 6 (TRPV6) Polyclonal Antibody (Human), FITC
4-PAF851Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRPV6 (Met578~Ile725)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Transient Receptor Potential Cation Channel Subfamily V, Member 6 (TRPV6). This antibody is labeled with FITC.
Transient Receptor Potential Cation Channel Subfamily V, Member 6 (TRPV6) Polyclonal Antibody (Human), HRP
4-PAF851Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRPV6 (Met578~Ile725)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Transient Receptor Potential Cation Channel Subfamily V, Member 6 (TRPV6). This antibody is labeled with HRP.
Transient Receptor Potential Cation Channel Subfamily V, Member 6 (TRPV6) Polyclonal Antibody (Human), PE
4-PAF851Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRPV6 (Met578~Ile725)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Transient Receptor Potential Cation Channel Subfamily V, Member 6 (TRPV6). This antibody is labeled with PE.
TRPV6 sgRNA CRISPR Lentivector (Human) (Target 1)
K2537402 1.0 ug DNA
EUR 154
TRPV6 sgRNA CRISPR Lentivector (Human) (Target 2)
K2537403 1.0 ug DNA
EUR 154
TRPV6 sgRNA CRISPR Lentivector (Human) (Target 3)
K2537404 1.0 ug DNA
EUR 154
Trpv6 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4389802 1.0 ug DNA
EUR 154
Trpv6 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4389803 1.0 ug DNA
EUR 154
Trpv6 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4389804 1.0 ug DNA
EUR 154
Trpv6 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7116702 1.0 ug DNA
EUR 154
Trpv6 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7116703 1.0 ug DNA
EUR 154
Trpv6 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7116704 1.0 ug DNA
EUR 154
TRPV6 Protein Vector (Human) (pPB-C-His)
PV044117 500 ng
EUR 329
TRPV6 Protein Vector (Human) (pPB-N-His)
PV044118 500 ng
EUR 329
TRPV6 Protein Vector (Human) (pPM-C-HA)
PV044119 500 ng
EUR 329
TRPV6 Protein Vector (Human) (pPM-C-His)
PV044120 500 ng
EUR 329
TRPV6 Protein Vector (Rat) (pPB-C-His)
PV313210 500 ng
EUR 1166
TRPV6 Protein Vector (Rat) (pPB-N-His)
PV313211 500 ng
EUR 1166
TRPV6 Protein Vector (Rat) (pPM-C-HA)
PV313212 500 ng
EUR 1166
TRPV6 Protein Vector (Rat) (pPM-C-His)
PV313213 500 ng
EUR 1166
TRPV6 Protein Vector (Mouse) (pPB-C-His)
PV242150 500 ng
EUR 1065
TRPV6 Protein Vector (Mouse) (pPB-N-His)
PV242151 500 ng
EUR 1065
TRPV6 Protein Vector (Mouse) (pPM-C-HA)
PV242152 500 ng
EUR 1065
TRPV6 Protein Vector (Mouse) (pPM-C-His)
PV242153 500 ng
EUR 1065
Trpv6 3'UTR GFP Stable Cell Line
TU171201 1.0 ml Ask for price
TRPV6 3'UTR GFP Stable Cell Line
TU077274 1.0 ml
EUR 1394
Trpv6 3'UTR Luciferase Stable Cell Line
TU121201 1.0 ml Ask for price
TRPV6 3'UTR Luciferase Stable Cell Line
TU027274 1.0 ml
EUR 1394
Trpv6 3'UTR Luciferase Stable Cell Line
TU222520 1.0 ml Ask for price
Trpv6 3'UTR GFP Stable Cell Line
TU272520 1.0 ml Ask for price
Transient Receptor Potential Cation Channel Subfamily V, Member 6 (TRPV6) Polyclonal Antibody (Human), APC-Cy7
4-PAF851Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRPV6 (Met578~Ile725)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Transient Receptor Potential Cation Channel Subfamily V, Member 6 (TRPV6). This antibody is labeled with APC-Cy7.
TRPV6 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV695887 1.0 ug DNA
EUR 1355
TRPV6 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV695891 1.0 ug DNA
EUR 1355
TRPV6 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV695892 1.0 ug DNA
EUR 1355
VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG14L Rabbit Polyclonal Antibody
ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG14L Rabbit Polyclonal Antibody
ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
WIPI2 Rabbit Polyclonal Antibody
ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
WIPI2 Rabbit Polyclonal Antibody
ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Gab1 Rabbit Polyclonal Antibody
ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Gab1 Rabbit Polyclonal Antibody
ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ERK1 Rabbit Polyclonal Antibody
ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ERK1 Rabbit Polyclonal Antibody
ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
NM23A Rabbit Polyclonal Antibody
ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
ATM Rabbit Polyclonal Antibody
ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
HSC70 Rabbit Polyclonal Antibody
ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

TRPV6 Rabbit Polyclonal Antibody