January 17, 2022

PTPRE Rabbit Polyclonal Antibody

PTPRE Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

PTPRE Polyclonal Antibody

ES10141-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PTPRE from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PTPRE Rabbit pAb

A4063-100ul 100 ul
EUR 308

PTPRE Rabbit pAb

A4063-200ul 200 ul
EUR 459

PTPRE Rabbit pAb

A4063-20ul 20 ul Ask for price

PTPRE Rabbit pAb

A4063-50ul 50 ul Ask for price

PTPRE Rabbit pAb

A7209-100ul 100 ul
EUR 308

PTPRE Rabbit pAb

A7209-200ul 200 ul
EUR 459

PTPRE Rabbit pAb

A7209-20ul 20 ul
EUR 183

PTPRE Rabbit pAb

A7209-50ul 50 ul
EUR 223

PTPRE antibody

70R-19648 50 ul
EUR 435
Description: Rabbit polyclonal PTPRE antibody

PTPRE Antibody

35900-100ul 100ul
EUR 252

PTPRE antibody

10R-5516 100 ul
EUR 691
Description: Mouse monoclonal PTPRE antibody

PTPRE antibody

10R-5518 100 ul
EUR 726
Description: Mouse monoclonal PTPRE antibody

PTPRE antibody

10R-5519 100 ul
EUR 691
Description: Mouse monoclonal PTPRE antibody

PTPRE antibody

10R-5521 100 ul
EUR 691
Description: Mouse monoclonal PTPRE antibody

PTPRE antibody

10R-5522 100 ul
EUR 691
Description: Mouse monoclonal PTPRE antibody

PTPRE antibody

10R-5526 100 ul
EUR 691
Description: Mouse monoclonal PTPRE antibody

PTPRE antibody

10R-5527 100 ul
EUR 691
Description: Mouse monoclonal PTPRE antibody

PTPRE antibody

10R-5528 100 ul
EUR 691
Description: Mouse monoclonal PTPRE antibody

PTPRE Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PTPRE. Recognizes PTPRE from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:15-1:50

PTPRE Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PTPRE. Recognizes PTPRE from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:15-1:50

PTPRE antibody

70R-7313 50 ug
EUR 467
Description: Rabbit polyclonal PTPRE antibody raised against the middle region of PTPRE

PTPRE Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PTPRE. Recognizes PTPRE from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

PTPRE Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PTPRE. Recognizes PTPRE from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Polyclonal PTPRE Antibody (N-term)

AMM07408G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PTPRE (N-term). This antibody is tested and proven to work in the following applications:

PTPRE Conjugated Antibody

C35900 100ul
EUR 397

anti- PTPRE antibody

FNab06944 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: protein tyrosine phosphatase, receptor type, E
  • Uniprot ID: P23469
  • Gene ID: 5791
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against PTPRE

Anti-PTPRE antibody

PAab06944 100 ug
EUR 412

Anti-PTPRE antibody

STJ111210 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. Several alternatively spliced transcript variants of this gene have been reported, at least two of which encode a receptor-type PTP that possesses a short extracellular domain, a single transmembrane region, and two tandem intracytoplasmic catalytic domains; another one encodes a PTP that contains a distinct hydrophilic N-terminus, and thus represents a nonreceptor-type isoform of this PTP. Studies of the similar gene in mice suggested the regulatory roles of this PTP in RAS related signal transduction pathways, cytokine-induced SATA signaling, as well as the activation of voltage-gated K+ channels.

Anti-PTPRE antibody

STJ29289 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. Several alternatively spliced transcript variants of this gene have been reported, at least two of which encode a receptor-type PTP that possesses a short extracellular domain, a single transmembrane region, and two tandem intracytoplasmic catalytic domains; another one encodes a PTP that contains a distinct hydrophilic N-terminus, and thus represents a nonreceptor-type isoform of this PTP. Studies of the similar gene in mice suggested the regulatory roles of this PTP in RAS related signal transduction pathways, cytokine-induced SATA signaling, as well as the activation of voltage-gated K+ channels.

Anti-PTPRE antibody

STJ191299 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PTPRE

Ptpre/ Rat Ptpre ELISA Kit

ELI-36784r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PTPRE Blocking Peptide

33R-9603 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PTPRE antibody, catalog no. 70R-7313

PTPRE cloning plasmid

CSB-CL019052HU-10ug 10ug
EUR 699
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2103
  • Sequence: atggagcccttgtgtccactcctgctggtgggttttagcttgccgctcgccagggctctcaggggcaacgagaccactgccgacagcaacgagacaaccacgacctcaggccctccggacccgggcgcctcccagccgctgctggcctggctgctactgccgctgctgctcctcc
  • Show more
Description: A cloning plasmid for the PTPRE gene.

Protein tyrosine phosphatase receptor type E (PTPRE) polyclonal antibody

ABP-PAB-11041 100 ug Ask for price
    • Product line: Phosphatases
    • Brand:


ELI-15704h 96 Tests
EUR 824


EF002180 96 Tests
EUR 689

Mouse Ptpre ELISA KIT

ELI-45475m 96 Tests
EUR 865

Mouse PTPRE shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat PTPRE shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PTPRE shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PTPRE Recombinant Protein (Human)

RP025225 100 ug Ask for price

PTPRE Recombinant Protein (Mouse)

RP165722 100 ug Ask for price

PTPRE Recombinant Protein (Rat)

RP222980 100 ug Ask for price

Protein Tyrosine Phosphatase Receptor Type E (PTPRE) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRE (Ile346~Gln500)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type E (PTPRE)

Protein Tyrosine Phosphatase Receptor Type E (PTPRE) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRE (Ile346~Gln500)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type E (PTPRE). This antibody is labeled with APC.

Protein Tyrosine Phosphatase Receptor Type E (PTPRE) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRE (Ile346~Gln500)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type E (PTPRE). This antibody is labeled with Biotin.

Protein Tyrosine Phosphatase Receptor Type E (PTPRE) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRE (Ile346~Gln500)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type E (PTPRE). This antibody is labeled with Cy3.

Protein Tyrosine Phosphatase Receptor Type E (PTPRE) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRE (Ile346~Gln500)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type E (PTPRE). This antibody is labeled with FITC.

Protein Tyrosine Phosphatase Receptor Type E (PTPRE) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRE (Ile346~Gln500)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type E (PTPRE). This antibody is labeled with HRP.

Protein Tyrosine Phosphatase Receptor Type E (PTPRE) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRE (Ile346~Gln500)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type E (PTPRE). This antibody is labeled with PE.

Ptpre ORF Vector (Rat) (pORF)

ORF074328 1.0 ug DNA
EUR 506

PTPRE ORF Vector (Human) (pORF)

ORF008409 1.0 ug DNA
EUR 95

Ptpre ORF Vector (Mouse) (pORF)

ORF055242 1.0 ug DNA
EUR 506

Protein Tyrosine Phosphatase Receptor Type E (PTPRE) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRE (Ile346~Gln500)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type E (PTPRE). This antibody is labeled with APC-Cy7.

Protein Tyrosine Phosphatase, Receptor Type E (PTPRE) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Protein Tyrosine Phosphatase, Receptor Type E (PTPRE) Antibody

abx028034-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Protein Tyrosine Phosphatase, Receptor Type E (PTPRE) Antibody

abx028034-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Protein Tyrosine Phosphatase Receptor Type E (PTPRE) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Protein Tyrosine Phosphatase Receptor Type E (PTPRE) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Protein Tyrosine Phosphatase, Receptor Type E (PTPRE) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Protein Tyrosine Phosphatase Receptor Type E (PTPRE) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Protein Tyrosine Phosphatase, Receptor Type E (PTPRE) Antibody

abx122352-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Protein Tyrosine Phosphatase, Receptor Type E (PTPRE) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Protein Tyrosine Phosphatase, Receptor Type E (PTPRE) Antibody

abx236944-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Ptpre sgRNA CRISPR Lentivector set (Rat)

K6986401 3 x 1.0 ug
EUR 339

Ptpre sgRNA CRISPR Lentivector set (Mouse)

K3402801 3 x 1.0 ug
EUR 339

PTPRE sgRNA CRISPR Lentivector set (Human)

K1757801 3 x 1.0 ug
EUR 339

Ptpre sgRNA CRISPR Lentivector (Rat) (Target 1)

K6986402 1.0 ug DNA
EUR 154

Ptpre sgRNA CRISPR Lentivector (Rat) (Target 2)

K6986403 1.0 ug DNA
EUR 154

Ptpre sgRNA CRISPR Lentivector (Rat) (Target 3)

K6986404 1.0 ug DNA
EUR 154

Ptpre sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3402802 1.0 ug DNA
EUR 154

Ptpre sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3402803 1.0 ug DNA
EUR 154

Ptpre sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3402804 1.0 ug DNA
EUR 154

PTPRE sgRNA CRISPR Lentivector (Human) (Target 1)

K1757802 1.0 ug DNA
EUR 154

PTPRE sgRNA CRISPR Lentivector (Human) (Target 2)

K1757803 1.0 ug DNA
EUR 154

PTPRE sgRNA CRISPR Lentivector (Human) (Target 3)

K1757804 1.0 ug DNA
EUR 154

PTPRE 3'UTR Luciferase Stable Cell Line

TU019223 1.0 ml
EUR 1521

Ptpre 3'UTR Luciferase Stable Cell Line

TU117290 1.0 ml Ask for price

Ptpre 3'UTR GFP Stable Cell Line

TU167290 1.0 ml Ask for price

Ptpre 3'UTR Luciferase Stable Cell Line

TU217083 1.0 ml Ask for price

Ptpre 3'UTR GFP Stable Cell Line

TU267083 1.0 ml Ask for price

PTPRE 3'UTR GFP Stable Cell Line

TU069223 1.0 ml
EUR 1521

PTPRE Protein Vector (Rat) (pPB-C-His)

PV297310 500 ng
EUR 1166

PTPRE Protein Vector (Rat) (pPB-N-His)

PV297311 500 ng
EUR 1166

PTPRE Protein Vector (Rat) (pPM-C-HA)

PV297312 500 ng
EUR 1166

PTPRE Protein Vector (Rat) (pPM-C-His)

PV297313 500 ng
EUR 1166

PTPRE Protein Vector (Human) (pPB-C-His)

PV033633 500 ng
EUR 329

PTPRE Protein Vector (Human) (pPB-N-His)

PV033634 500 ng
EUR 329

PTPRE Protein Vector (Human) (pPM-C-HA)

PV033635 500 ng
EUR 329

PTPRE Protein Vector (Human) (pPM-C-His)

PV033636 500 ng
EUR 329

PTPRE Protein Vector (Mouse) (pPB-C-His)

PV220966 500 ng
EUR 1065

PTPRE Protein Vector (Mouse) (pPB-N-His)

PV220967 500 ng
EUR 1065

PTPRE Rabbit Polyclonal Antibody