October 23, 2021

PLS1 Rabbit Polyclonal Antibody

PLS1 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

PLS1 Polyclonal Antibody

ABP59945-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PLS1 protein at amino acid sequence of 170-250
  • Applications tips:
Description: A polyclonal antibody for detection of PLS1 from Human. This PLS1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLS1 protein at amino acid sequence of 170-250

PLS1 Polyclonal Antibody

ES10002-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PLS1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

PLS1 Polyclonal Antibody

ES10002-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PLS1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Plastin 1 (PLS1) ELISA Kit

DLR-PLS1-Hu-48T 48T
EUR 517
  • Should the Human Plastin 1 (PLS1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Plastin 1 (PLS1) in samples from tissue homogenates or other biological fluids.

Human Plastin 1 (PLS1) ELISA Kit

DLR-PLS1-Hu-96T 96T
EUR 673
  • Should the Human Plastin 1 (PLS1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Plastin 1 (PLS1) in samples from tissue homogenates or other biological fluids.

Human Plastin 1 (PLS1) ELISA Kit

RDR-PLS1-Hu-48Tests 48 Tests
EUR 544

Human Plastin 1 (PLS1) ELISA Kit

RDR-PLS1-Hu-96Tests 96 Tests
EUR 756

Human Plastin 1 (PLS1) ELISA Kit

RD-PLS1-Hu-48Tests 48 Tests
EUR 521

Human Plastin 1 (PLS1) ELISA Kit

RD-PLS1-Hu-96Tests 96 Tests
EUR 723

PLS1 Rabbit pAb

A15303-100ul 100 ul
EUR 308

PLS1 Rabbit pAb

A15303-200ul 200 ul
EUR 459

PLS1 Rabbit pAb

A15303-20ul 20 ul
EUR 183

PLS1 Rabbit pAb

A15303-50ul 50 ul
EUR 223

PLS1 Rabbit pAb

A3626-100ul 100 ul
EUR 308

PLS1 Rabbit pAb

A3626-200ul 200 ul
EUR 459

PLS1 Rabbit pAb

A3626-20ul 20 ul Ask for price

PLS1 Rabbit pAb

A3626-50ul 50 ul Ask for price

PLS1 Polyclonal Conjugated Antibody

C28906 100ul
EUR 397

PLS1 antibody

70R-19356 50 ul
EUR 435
Description: Rabbit polyclonal PLS1 antibody

PLS1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PLS1. Recognizes PLS1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF, IP; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500, IF:1:50-1:200, IP:1:200-1:2000

PLS1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PLS1. Recognizes PLS1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Polyclonal PLS1 Antibody (C-term)

APR14377G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PLS1 (C-term). This antibody is tested and proven to work in the following applications:

anti- PLS1 antibody

FNab06557 100µg
EUR 548.75
  • Immunogen: plastin 1(I isoform)
  • Uniprot ID: Q14651
  • Gene ID: 5357
  • Research Area: Signal Transduction
Description: Antibody raised against PLS1

Anti-PLS1 antibody

PAab06557 100 ug
EUR 386

Anti-PLS1 antibody

STJ26429 100 µl
EUR 277
Description: Plastins are a family of actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. In humans, two ubiquitous plastin isoforms (L and T) have been identified. The protein encoded by this gene is a third distinct plastin isoform, which is specifically expressed at high levels in the small intestine. Alternatively spliced transcript variants varying in the 5' UTR, but encoding the same protein, have been found for this gene. A pseudogene of this gene is found on chromosome 11.

Anti-PLS1 antibody

STJ117498 100 µl
EUR 277
Description: Plastins are a family of actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. In humans, two ubiquitous plastin isoforms (L and T) have been identified. The protein encoded by this gene is a third distinct plastin isoform, which is specifically expressed at high levels in the small intestine. Alternatively spliced transcript variants varying in the 5' UTR, but encoding the same protein, have been found for this gene. A pseudogene of this gene is found on chromosome 11.

Anti-PLS1 antibody

STJ191160 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PLS1


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PLS1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PLS1. Recognizes PLS1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PLS1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PLS1. Recognizes PLS1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PLS1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PLS1. Recognizes PLS1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Plastin-1 (PLS1) Antibody

abx027237-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Plastin-1 (PLS1) Antibody

abx027237-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Plastin 1 (PLS1) Antibody

  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Plastin 1 (PLS1) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Plastin-1 (PLS1) Antibody

abx236557-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Plastin-1 (PLS1) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

PLS1 cloning plasmid

CSB-CL623928HU-10ug 10ug
EUR 639
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1890
  • Sequence: atggaaaacagtactactaccatttctcgggaggagcttgaagaactacaagaggcatttaataaaatagatattgacaatagtgggtatgtcagtgactatgaacttcaagacctgtttaaggaagcaagccttcctctgcctggctacaaggtgcgcgagattgtggagaaaa
  • Show more
Description: A cloning plasmid for the PLS1 gene.

Anti-PLS1 (3G10)

YF-MA10706 100 ug
EUR 363
Description: Mouse monoclonal to PLS1


EF001870 96 Tests
EUR 689

Human PLS1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PLS1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PLS1 Recombinant Protein (Human)

RP023836 100 ug Ask for price

PLS1 Recombinant Protein (Mouse)

RP162965 100 ug Ask for price

PLS1 Recombinant Protein (Rat)

RP221051 100 ug Ask for price

Monoclonal PLS1 Antibody (monoclonal) (M04), Clone: 3G10

AMM07254G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human PLS1 (monoclonal) (M04). The antibodies are raised in mouse and are from clone 3G10. This antibody is applicable in WB, E

Human Plastin 1 (PLS1) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Pls1 ORF Vector (Rat) (pORF)

ORF073685 1.0 ug DNA
EUR 506

PLS1 ORF Vector (Human) (pORF)

ORF007946 1.0 ug DNA
EUR 95

Pls1 ORF Vector (Mouse) (pORF)

ORF054323 1.0 ug DNA
EUR 506

PLS1 ELISA Kit (Human) (OKCD01954)

OKCD01954 96 Wells
EUR 831
Description: Description of target: Actin-bundling protein in the absence of calcium. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.115 ng/mL

Human Plastin 1 (PLS1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Plastin- 1, Pls1 ELISA KIT

ELI-15327m 96 Tests
EUR 865

Bovine Plastin- 1, PLS1 ELISA KIT

ELI-15354b 96 Tests
EUR 928

Chicken Plastin- 1, PLS1 ELISA KIT

ELI-45344c 96 Tests
EUR 928

Human Plastin 1 (PLS1) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Plastin-1 (PLS1) ELISA Kit

abx390256-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Plastin- 1, PLS1 ELISA KIT

ELI-38041h 96 Tests
EUR 824

Pls1 sgRNA CRISPR Lentivector set (Rat)

K7573101 3 x 1.0 ug
EUR 339

Pls1 sgRNA CRISPR Lentivector set (Mouse)

K3561201 3 x 1.0 ug
EUR 339

PLS1 sgRNA CRISPR Lentivector set (Human)

K1670401 3 x 1.0 ug
EUR 339

PLS1-AS1 ORF Vector (Human) (pORF)

ORF027978 1.0 ug DNA Ask for price

Human Plastin 1(PLS1)ELISA Kit

QY-E01396 96T
EUR 361

Human Plastin 1 (PLS1) ELISA Kit

SEH366Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Plastin 1 (PLS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Plastin 1 (PLS1) in Tissue homogenates and other biological fluids.

Human Plastin 1 (PLS1) ELISA Kit

SEH366Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Plastin 1 (PLS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Plastin 1 (PLS1) in Tissue homogenates and other biological fluids.

Human Plastin 1 (PLS1) ELISA Kit

SEH366Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Plastin 1 (PLS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Plastin 1 (PLS1) in Tissue homogenates and other biological fluids.

Human Plastin 1 (PLS1) ELISA Kit

SEH366Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Plastin 1 (PLS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Plastin 1 (PLS1) in Tissue homogenates and other biological fluids.

Human Plastin 1 (PLS1) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Plastin 1 elisa. Alternative names of the recognized antigen: I-plastin
  • Fimbrin
  • Intestine-specific plastin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Plastin 1 (PLS1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

ELISA kit for Human PLS1 (Plastin 1)

ELK4168 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Plastin 1 (PLS1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Plastin 1 (PLS1).
  • Show more
Description: A sandwich ELISA kit for detection of Plastin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Pls1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7573102 1.0 ug DNA
EUR 154

Pls1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7573103 1.0 ug DNA
EUR 154

Pls1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7573104 1.0 ug DNA
EUR 154

Pls1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3561202 1.0 ug DNA
EUR 154

Pls1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3561203 1.0 ug DNA
EUR 154

Pls1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3561204 1.0 ug DNA
EUR 154

PLS1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1670402 1.0 ug DNA
EUR 154

PLS1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1670403 1.0 ug DNA
EUR 154

PLS1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1670404 1.0 ug DNA
EUR 154

ELISA kit for Mouse Plastin-1 (PLS1)

KTE70725-48T 48T
EUR 332
  • Plastins are a family of actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. In humans, two ubiquitous plastin isoforms (L and T) have been identified. The protein encoded by th
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Plastin-1 (PLS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Plastin-1 (PLS1)

KTE70725-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Plastins are a family of actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. In humans, two ubiquitous plastin isoforms (L and T) have been identified. The protein encoded by th
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Plastin-1 (PLS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Plastin-1 (PLS1)

KTE70725-96T 96T
EUR 539
  • Plastins are a family of actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. In humans, two ubiquitous plastin isoforms (L and T) have been identified. The protein encoded by th
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Plastin-1 (PLS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

PLS1 Protein Vector (Rat) (pPB-C-His)

PV294738 500 ng
EUR 603

PLS1 Protein Vector (Rat) (pPB-N-His)

PV294739 500 ng
EUR 603

PLS1 Protein Vector (Rat) (pPM-C-HA)

PV294740 500 ng
EUR 603

PLS1 Protein Vector (Rat) (pPM-C-His)

PV294741 500 ng
EUR 603

PLS1 Protein Vector (Human) (pPB-C-His)

PV031781 500 ng
EUR 329

PLS1 Protein Vector (Human) (pPB-N-His)

PV031782 500 ng
EUR 329

PLS1 Protein Vector (Human) (pPM-C-HA)

PV031783 500 ng
EUR 329

PLS1 Protein Vector (Human) (pPM-C-His)

PV031784 500 ng
EUR 329

PLS1 Protein Vector (Mouse) (pPB-C-His)

PV217290 500 ng
EUR 603

PLS1 Protein Vector (Mouse) (pPB-N-His)

PV217291 500 ng
EUR 603

PLS1 Protein Vector (Mouse) (pPM-C-HA)

PV217292 500 ng
EUR 603

PLS1 Protein Vector (Mouse) (pPM-C-His)

PV217293 500 ng
EUR 603

Pls1 3'UTR Luciferase Stable Cell Line

TU116572 1.0 ml Ask for price

Pls1 3'UTR GFP Stable Cell Line

TU166572 1.0 ml Ask for price

Pls1 3'UTR Luciferase Stable Cell Line

TU216429 1.0 ml Ask for price

Pls1 3'UTR GFP Stable Cell Line

TU266429 1.0 ml Ask for price

PLS1 3'UTR GFP Stable Cell Line

TU068290 1.0 ml
EUR 1521

PLS1 3'UTR Luciferase Stable Cell Line

TU018290 1.0 ml
EUR 1521

Pls1 ELISA Kit| Mouse Plastin-1 ELISA Kit

EF015895 96 Tests
EUR 689

PLS1 ELISA Kit| Bovine Plastin-1 ELISA Kit

EF011765 96 Tests
EUR 689

PLS1 ELISA Kit| chicken Plastin-1 ELISA Kit

EF012466 96 Tests
EUR 689

PLS1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV639385 1.0 ug DNA
EUR 682

PLS1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV639389 1.0 ug DNA
EUR 682

PLS1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV639390 1.0 ug DNA
EUR 682

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

PLS1 Rabbit Polyclonal Antibody