RAB15 Rabbit Polyclonal Antibody

RAB15 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

RAB15 Polyclonal Antibody
ABP60058-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human RAB15 protein at amino acid sequence of 80-160 Applications tips:
Description: A polyclonal antibody for detection of RAB15 from Human, Mouse, Rat. This RAB15 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB15 protein at amino acid sequence of 80-160

RAB15 Polyclonal Antibody
ES10112-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against RAB15 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RAB15 Polyclonal Antibody
ES10112-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against RAB15 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RAB15 Antibody
46177-100ul	SAB	100ul	EUR 252

RAB15 Antibody
46177-50ul	SAB	50ul	EUR 187

RAB15 Antibody
DF9814	Affbiotech	200ul	EUR 304
Description: RAB15 Antibody detects endogenous levels of total RAB15.

RAB15 antibody
70R-9363	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal RAB15 antibody

RAB15 antibody
70R-5831	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal RAB15 antibody raised against the N terminal of RAB15

RAB15 Antibody
ABD13221	Lifescience Market	100 ug	EUR 438

RAB15 Antibody
ABD9814	Lifescience Market	100 ug	EUR 438

Rab15/ Rat Rab15 ELISA Kit
ELI-36011r	Lifescience Market	96 Tests	EUR 886

RAB15 Conjugated Antibody
C46177	SAB	100ul	EUR 397

Anti-Rab15 antibody
STJ140094	St John's Laboratory	200 µg	EUR 231
Description: RAB15 belongs to the large RAB family of low molecular weight GTPases that are involved in intracellular membrane trafficking. Rab15 might differentially regulate distinct steps in membrane trafficking through early/sorting and pericentriolar recycling endosomes.

Anti-RAB15 antibody
STJ191270	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to RAB15

RAB15 siRNA
20-abx930603	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RAB15 siRNA
20-abx930604	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RAB15 Blocking Peptide
33R-8810	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAB15 antibody, catalog no. 70R-5831

RAB15 Blocking Peptide
33R-7752	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAB15 antibody, catalog no. 70R-9363

RAB15 Blocking Peptide
DF9814-BP	Affbiotech	1mg	EUR 195

RAB15 cloning plasmid
CSB-CL019163HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 627 Sequence: atggcgaagcagtacgatgtgctgttccggctgctgctgatcggggactccggggtgggcaagacctgcctgctgtgccgcttcaccgacaacgagttccactcctcgcacatctccaccatcggtgttgactttaagatgaagaccatagaggtagacggcatcaaagtgcggat Show more
Description: A cloning plasmid for the RAB15 gene.

Anti-RAB15 (1G12)
YF-MA20136	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to RAB15

Rat RAB15 shRNA Plasmid
20-abx988978	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human RAB15 shRNA Plasmid
20-abx967688	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RAB15 Recombinant Protein (Human)
RP025420	ABM	100 ug	Ask for price

RAB15 Recombinant Protein (Mouse)
RP166199	ABM	100 ug	Ask for price

RAB15 Recombinant Protein (Rat)
RP223253	ABM	100 ug	Ask for price

Ras-Related Protein Rab-15 (RAB15) Antibody
20-abx218108	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Ras-Related Protein Rab-15 (RAB15) Antibody
abx029052-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Ras-Related Protein Rab-15 (RAB15) Antibody
abx029052-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Monoclonal RAB15 Antibody (monoclonal) (M01), Clone: 1G12
AMM07445G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human RAB15 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1G12. This antibody is applicable in WB

Rab15 ORF Vector (Rat) (pORF)
ORF074419	ABM	1.0 ug DNA	EUR 506

RAB15 ORF Vector (Human) (pORF)
ORF008474	ABM	1.0 ug DNA	EUR 95

Rab15 ORF Vector (Mouse) (pORF)
ORF055401	ABM	1.0 ug DNA	EUR 506

Rab15 sgRNA CRISPR Lentivector set (Rat)
K7212101	ABM	3 x 1.0 ug	EUR 339

Rab15 sgRNA CRISPR Lentivector set (Mouse)
K4447001	ABM	3 x 1.0 ug	EUR 339

RAB15 sgRNA CRISPR Lentivector set (Human)
K1771901	ABM	3 x 1.0 ug	EUR 339

Mouse Rab15 effector protein, Rep15 ELISA KIT
ELI-14196m	Lifescience Market	96 Tests	EUR 865

Human Rab15 effector protein, REP15 ELISA KIT
ELI-30121h	Lifescience Market	96 Tests	EUR 824

Human RAB15 effector protein (REP15) ELISA Kit
abx385341-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse RAB15 effector protein (REP15) ELISA Kit
abx390388-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rab15 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7212102	ABM	1.0 ug DNA	EUR 154

Rab15 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7212103	ABM	1.0 ug DNA	EUR 154

Rab15 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7212104	ABM	1.0 ug DNA	EUR 154

Rab15 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4447002	ABM	1.0 ug DNA	EUR 154

Rab15 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4447003	ABM	1.0 ug DNA	EUR 154

Rab15 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4447004	ABM	1.0 ug DNA	EUR 154

RAB15 sgRNA CRISPR Lentivector (Human) (Target 1)
K1771902	ABM	1.0 ug DNA	EUR 154

RAB15 sgRNA CRISPR Lentivector (Human) (Target 2)
K1771903	ABM	1.0 ug DNA	EUR 154

RAB15 sgRNA CRISPR Lentivector (Human) (Target 3)
K1771904	ABM	1.0 ug DNA	EUR 154

RAB15 Protein Vector (Rat) (pPB-C-His)
PV297674	ABM	500 ng	EUR 603

RAB15 Protein Vector (Rat) (pPB-N-His)
PV297675	ABM	500 ng	EUR 603

RAB15 Protein Vector (Rat) (pPM-C-HA)
PV297676	ABM	500 ng	EUR 603

RAB15 Protein Vector (Rat) (pPM-C-His)
PV297677	ABM	500 ng	EUR 603

RAB15 Protein Vector (Human) (pPB-C-His)
PV033893	ABM	500 ng	EUR 329

RAB15 Protein Vector (Human) (pPB-N-His)
PV033894	ABM	500 ng	EUR 329

RAB15 Protein Vector (Human) (pPM-C-HA)
PV033895	ABM	500 ng	EUR 329

RAB15 Protein Vector (Human) (pPM-C-His)
PV033896	ABM	500 ng	EUR 329

RAB15 Protein Vector (Mouse) (pPB-C-His)
PV221602	ABM	500 ng	EUR 603

RAB15 Protein Vector (Mouse) (pPB-N-His)
PV221603	ABM	500 ng	EUR 603

RAB15 Protein Vector (Mouse) (pPM-C-HA)
PV221604	ABM	500 ng	EUR 603

RAB15 Protein Vector (Mouse) (pPM-C-His)
PV221605	ABM	500 ng	EUR 603

Rab15 3'UTR Luciferase Stable Cell Line
TU117392	ABM	1.0 ml	Ask for price

Rab15 3'UTR GFP Stable Cell Line
TU167392	ABM	1.0 ml	Ask for price

Rab15 3'UTR Luciferase Stable Cell Line
TU217177	ABM	1.0 ml	Ask for price

Rab15 3'UTR GFP Stable Cell Line
TU267177	ABM	1.0 ml	Ask for price

RAB15 3'UTR GFP Stable Cell Line
TU069369	ABM	1.0 ml	EUR 1521

RAB15 3'UTR Luciferase Stable Cell Line
TU019369	ABM	1.0 ml	EUR 1521

RAB15 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV680227	ABM	1.0 ug DNA	EUR 514

RAB15 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV680231	ABM	1.0 ug DNA	EUR 514

RAB15 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV680232	ABM	1.0 ug DNA	EUR 514

RAB15 Rabbit Polyclonal Antibody