October 26, 2021

RAB15 Rabbit Polyclonal Antibody

RAB15 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

RAB15 Polyclonal Antibody

ABP60058-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RAB15 protein at amino acid sequence of 80-160
  • Applications tips:
Description: A polyclonal antibody for detection of RAB15 from Human, Mouse, Rat. This RAB15 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB15 protein at amino acid sequence of 80-160

RAB15 Polyclonal Antibody

ES10112-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RAB15 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RAB15 Polyclonal Antibody

ES10112-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RAB15 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RAB15 Antibody

46177-100ul 100ul
EUR 252

RAB15 Antibody

46177-50ul 50ul
EUR 187

RAB15 Antibody

DF9814 200ul
EUR 304
Description: RAB15 Antibody detects endogenous levels of total RAB15.

RAB15 antibody

70R-9363 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal RAB15 antibody

RAB15 antibody

70R-5831 50 ug
EUR 467
Description: Rabbit polyclonal RAB15 antibody raised against the N terminal of RAB15

RAB15 Antibody

ABD13221 100 ug
EUR 438

RAB15 Antibody

ABD9814 100 ug
EUR 438

Rab15/ Rat Rab15 ELISA Kit

ELI-36011r 96 Tests
EUR 886

RAB15 Conjugated Antibody

C46177 100ul
EUR 397

Anti-Rab15 antibody

STJ140094 200 µg
EUR 231
Description: RAB15 belongs to the large RAB family of low molecular weight GTPases that are involved in intracellular membrane trafficking. Rab15 might differentially regulate distinct steps in membrane trafficking through early/sorting and pericentriolar recycling endosomes.

Anti-RAB15 antibody

STJ191270 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RAB15

RAB15 siRNA

20-abx930603
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB15 siRNA

20-abx930604
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB15 Blocking Peptide

33R-8810 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAB15 antibody, catalog no. 70R-5831

RAB15 Blocking Peptide

33R-7752 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAB15 antibody, catalog no. 70R-9363

RAB15 Blocking Peptide

DF9814-BP 1mg
EUR 195

RAB15 cloning plasmid

CSB-CL019163HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 627
  • Sequence: atggcgaagcagtacgatgtgctgttccggctgctgctgatcggggactccggggtgggcaagacctgcctgctgtgccgcttcaccgacaacgagttccactcctcgcacatctccaccatcggtgttgactttaagatgaagaccatagaggtagacggcatcaaagtgcggat
  • Show more
Description: A cloning plasmid for the RAB15 gene.

Anti-RAB15 (1G12)

YF-MA20136 100 ug
EUR 363
Description: Mouse monoclonal to RAB15

Rat RAB15 shRNA Plasmid

20-abx988978
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RAB15 shRNA Plasmid

20-abx967688
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RAB15 Recombinant Protein (Human)

RP025420 100 ug Ask for price

RAB15 Recombinant Protein (Mouse)

RP166199 100 ug Ask for price

RAB15 Recombinant Protein (Rat)

RP223253 100 ug Ask for price

Ras-Related Protein Rab-15 (RAB15) Antibody

20-abx218108
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ras-Related Protein Rab-15 (RAB15) Antibody

abx029052-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Ras-Related Protein Rab-15 (RAB15) Antibody

abx029052-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Monoclonal RAB15 Antibody (monoclonal) (M01), Clone: 1G12

AMM07445G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human RAB15 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1G12. This antibody is applicable in WB

Rab15 ORF Vector (Rat) (pORF)

ORF074419 1.0 ug DNA
EUR 506

RAB15 ORF Vector (Human) (pORF)

ORF008474 1.0 ug DNA
EUR 95

Rab15 ORF Vector (Mouse) (pORF)

ORF055401 1.0 ug DNA
EUR 506

Rab15 sgRNA CRISPR Lentivector set (Rat)

K7212101 3 x 1.0 ug
EUR 339

Rab15 sgRNA CRISPR Lentivector set (Mouse)

K4447001 3 x 1.0 ug
EUR 339

RAB15 sgRNA CRISPR Lentivector set (Human)

K1771901 3 x 1.0 ug
EUR 339

Mouse Rab15 effector protein, Rep15 ELISA KIT

ELI-14196m 96 Tests
EUR 865

Human Rab15 effector protein, REP15 ELISA KIT

ELI-30121h 96 Tests
EUR 824

Human RAB15 effector protein (REP15) ELISA Kit

abx385341-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse RAB15 effector protein (REP15) ELISA Kit

abx390388-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rab15 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7212102 1.0 ug DNA
EUR 154

Rab15 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7212103 1.0 ug DNA
EUR 154

Rab15 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7212104 1.0 ug DNA
EUR 154

Rab15 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4447002 1.0 ug DNA
EUR 154

Rab15 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4447003 1.0 ug DNA
EUR 154

Rab15 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4447004 1.0 ug DNA
EUR 154

RAB15 sgRNA CRISPR Lentivector (Human) (Target 1)

K1771902 1.0 ug DNA
EUR 154

RAB15 sgRNA CRISPR Lentivector (Human) (Target 2)

K1771903 1.0 ug DNA
EUR 154

RAB15 sgRNA CRISPR Lentivector (Human) (Target 3)

K1771904 1.0 ug DNA
EUR 154

RAB15 Protein Vector (Rat) (pPB-C-His)

PV297674 500 ng
EUR 603

RAB15 Protein Vector (Rat) (pPB-N-His)

PV297675 500 ng
EUR 603

RAB15 Protein Vector (Rat) (pPM-C-HA)

PV297676 500 ng
EUR 603

RAB15 Protein Vector (Rat) (pPM-C-His)

PV297677 500 ng
EUR 603

RAB15 Protein Vector (Human) (pPB-C-His)

PV033893 500 ng
EUR 329

RAB15 Protein Vector (Human) (pPB-N-His)

PV033894 500 ng
EUR 329

RAB15 Protein Vector (Human) (pPM-C-HA)

PV033895 500 ng
EUR 329

RAB15 Protein Vector (Human) (pPM-C-His)

PV033896 500 ng
EUR 329

RAB15 Protein Vector (Mouse) (pPB-C-His)

PV221602 500 ng
EUR 603

RAB15 Protein Vector (Mouse) (pPB-N-His)

PV221603 500 ng
EUR 603

RAB15 Protein Vector (Mouse) (pPM-C-HA)

PV221604 500 ng
EUR 603

RAB15 Protein Vector (Mouse) (pPM-C-His)

PV221605 500 ng
EUR 603

Rab15 3'UTR Luciferase Stable Cell Line

TU117392 1.0 ml Ask for price

Rab15 3'UTR GFP Stable Cell Line

TU167392 1.0 ml Ask for price

Rab15 3'UTR Luciferase Stable Cell Line

TU217177 1.0 ml Ask for price

Rab15 3'UTR GFP Stable Cell Line

TU267177 1.0 ml Ask for price

RAB15 3'UTR GFP Stable Cell Line

TU069369 1.0 ml
EUR 1521

RAB15 3'UTR Luciferase Stable Cell Line

TU019369 1.0 ml
EUR 1521

RAB15 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV680227 1.0 ug DNA
EUR 514

RAB15 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV680231 1.0 ug DNA
EUR 514

RAB15 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV680232 1.0 ug DNA
EUR 514

RAB15 Rabbit Polyclonal Antibody