October 26, 2021

PTPRB Rabbit Polyclonal Antibody

PTPRB Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

PTPRB Polyclonal Antibody

ABP60035-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PTPRB protein at amino acid sequence of 280-360
  • Applications tips:
Description: A polyclonal antibody for detection of PTPRB from Human. This PTPRB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTPRB protein at amino acid sequence of 280-360

PTPRB Polyclonal Antibody

ES10139-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PTPRB from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

PTPRB Polyclonal Antibody

ES10139-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PTPRB from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

PTPRB Antibody

46194-100ul 100ul
EUR 252

PTPRB Antibody

46194-50ul 50ul
EUR 187

PTPRB Antibody

DF9841 200ul
EUR 304
Description: PTPRB Antibody detects endogenous levels of total PTPRB.

PTPRB Antibody

1-CSB-PA019048ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PTPRB. Recognizes PTPRB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

PTPRB Antibody

ABD9841 100 ug
EUR 438

Rabbit PTPRB ELISA Kit

ERTP0175 96Tests
EUR 521

Polyclonal PTPRB Antibody (internal region)

AMM07406G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human PTPRB (internal region). This antibody is tested and proven to work in the following applications:

PTPRB Conjugated Antibody

C46194 100ul
EUR 397

Anti-PTPRB antibody

STJ72286 100 µg
EUR 359

Anti-PTPRB antibody

STJ191297 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PTPRB

PTPRB siRNA

20-abx930393
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PTPRB siRNA

20-abx930394
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pOTB7-PTPRB

PVT18153 2 ug
EUR 258

PTPRB Blocking Peptide

DF9841-BP 1mg
EUR 195

PTPRB cloning plasmid

CSB-CL019048HU1-10ug 10ug
EUR 758
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2316
  • Sequence: atggaggctgaattttacatggtgattcttacctgcttgatcttcaggaactcagaagggtttcagattgtccatgtccagaaacaacagtgtcttttcaaaaatgagaaagtggtcgtgggctcatgcaacaggaccatccagaaccagcagtggatgtggactgaggatgaaa
  • Show more
Description: A cloning plasmid for the PTPRB gene.

PTPRB cloning plasmid

CSB-CL019048HU2-10ug 10ug
EUR 2770
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 5994
  • Sequence: ATGCTGAGCCATGGAGCCGGGTTGGCCTTGTGGATCACACTGAGCCTGCTGCAGACTGGACTGGCGGAGCCAGAGAGATGTAACTTCACCCTGGCGGAGTCCAAGGCCTCCAGCCATTCTGTGTCTATCCAGTGGAGAATTTTGGGCTCACCCTGTAACTTTAGCCTCATCTATA
  • Show more
Description: A cloning plasmid for the PTPRB gene.

pCR4-TOPO-PTPRB

PVT18197 2 ug
EUR 383

Protein tyrosine phosphatase receptor type B (PTPRB) polyclonal antibody

ABP-PAB-11037 100 ug Ask for price
    • Product line: Phosphatases
    • Brand:

Human PTPRB ELISA Kit

EHP0175 96Tests
EUR 521

Bovine PTPRB ELISA Kit

EBP0175 96Tests
EUR 521

Anserini PTPRB ELISA Kit

EAP0175 96Tests
EUR 521

Canine PTPRB ELISA Kit

ECP0175 96Tests
EUR 521

Goat PTPRB ELISA Kit

EGTP0175 96Tests
EUR 521

Human PTPRB ELISA KIT

ELI-16748h 96 Tests
EUR 824

Mouse PTPRB shRNA Plasmid

20-abx972300
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PTPRB shRNA Plasmid

20-abx953909
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Porcine PTPRB ELISA Kit

EPP0175 96Tests
EUR 521

Rat PTPRB ELISA Kit

ERP0175 96Tests
EUR 521

Mouse PTPRB ELISA Kit

EMP0175 96Tests
EUR 521

Mouse Ptprb ELISA KIT

ELI-35907m 96 Tests
EUR 865

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Human)

4-PAB048Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRB (Ala1655~Asp1918)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type B (PTPRB)

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Mouse)

4-PAB048Mu01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRB (Gly1214~Val1463)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Protein Tyrosine Phosphatase Receptor Type B (PTPRB)

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Rat)

4-PAB048Ra01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRB (Asn1041~Tyr1310)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Protein Tyrosine Phosphatase Receptor Type B (PTPRB)

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Human), APC

4-PAB048Hu01-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRB (Ala1655~Asp1918)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with APC.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Human), Biotinylated

4-PAB048Hu01-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRB (Ala1655~Asp1918)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with Biotin.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Human), Cy3

4-PAB048Hu01-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRB (Ala1655~Asp1918)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with Cy3.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Human), FITC

4-PAB048Hu01-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRB (Ala1655~Asp1918)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with FITC.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Human), HRP

4-PAB048Hu01-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRB (Ala1655~Asp1918)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with HRP.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Human), PE

4-PAB048Hu01-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRB (Ala1655~Asp1918)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with PE.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Mouse), APC

4-PAB048Mu01-APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRB (Gly1214~Val1463)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with APC.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Mouse), Biotinylated

4-PAB048Mu01-Biotin
  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRB (Gly1214~Val1463)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with Biotin.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Mouse), Cy3

4-PAB048Mu01-Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRB (Gly1214~Val1463)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with Cy3.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Mouse), FITC

4-PAB048Mu01-FITC
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRB (Gly1214~Val1463)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with FITC.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Mouse), HRP

4-PAB048Mu01-HRP
  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRB (Gly1214~Val1463)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with HRP.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Mouse), PE

4-PAB048Mu01-PE
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRB (Gly1214~Val1463)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with PE.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Rat), APC

4-PAB048Ra01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRB (Asn1041~Tyr1310)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with APC.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Rat), Biotinylated

4-PAB048Ra01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRB (Asn1041~Tyr1310)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with Biotin.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Rat), Cy3

4-PAB048Ra01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRB (Asn1041~Tyr1310)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with Cy3.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Rat), FITC

4-PAB048Ra01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRB (Asn1041~Tyr1310)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with FITC.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Rat), HRP

4-PAB048Ra01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRB (Asn1041~Tyr1310)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with HRP.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Rat), PE

4-PAB048Ra01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRB (Asn1041~Tyr1310)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with PE.

Guinea Pig PTPRB ELISA Kit

EGP0175 96Tests
EUR 521

PTPRB ORF Vector (Human) (pORF)

ORF014204 1.0 ug DNA
EUR 354

PTPRB ORF Vector (Human) (pORF)

ORF008408 1.0 ug DNA
EUR 95

Ptprb ORF Vector (Mouse) (pORF)

ORF055236 1.0 ug DNA
EUR 1572

Rabbit Protein Tyrosine Phosphatase Receptor Type B (PTPRB) ELISA Kit

abx363023-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Human), APC-Cy7

4-PAB048Hu01-APC-Cy7
  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRB (Ala1655~Asp1918)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with APC-Cy7.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Mouse), APC-Cy7

4-PAB048Mu01-APC-Cy7
  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRB (Gly1214~Val1463)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with APC-Cy7.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Rat), APC-Cy7

4-PAB048Ra01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRB (Asn1041~Tyr1310)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with APC-Cy7.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Antibody

20-abx218060
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Antibody

20-abx104375
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Antibody

20-abx130068
  • EUR 314.00
  • EUR 133.00
  • EUR 829.00
  • EUR 439.00
  • EUR 272.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Antibody

20-abx131514
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Antibody

20-abx320809
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Antibody

abx431909-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

Ptprb sgRNA CRISPR Lentivector set (Mouse)

K4358701 3 x 1.0 ug
EUR 339

PTPRB sgRNA CRISPR Lentivector set (Human)

K1757401 3 x 1.0 ug
EUR 339

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Antibody (FITC)

20-abx274236
  • EUR 467.00
  • EUR 244.00
  • EUR 1358.00
  • EUR 648.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Ptprb sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4358702 1.0 ug DNA
EUR 154

Ptprb sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4358703 1.0 ug DNA
EUR 154

Ptprb sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4358704 1.0 ug DNA
EUR 154

PTPRB sgRNA CRISPR Lentivector (Human) (Target 1)

K1757402 1.0 ug DNA
EUR 154

PTPRB sgRNA CRISPR Lentivector (Human) (Target 2)

K1757403 1.0 ug DNA
EUR 154

PTPRB sgRNA CRISPR Lentivector (Human) (Target 3)

K1757404 1.0 ug DNA
EUR 154

PTPRB Protein Vector (Human) (pPB-C-His)

PV033629 500 ng
EUR 329

PTPRB Protein Vector (Human) (pPB-N-His)

PV033630 500 ng
EUR 329

PTPRB Protein Vector (Human) (pPM-C-HA)

PV033631 500 ng
EUR 329

PTPRB Protein Vector (Human) (pPM-C-His)

PV033632 500 ng
EUR 329

PTPRB Protein Vector (Human) (pPB-C-His)

PV056813 500 ng
EUR 481

PTPRB Protein Vector (Human) (pPB-N-His)

PV056814 500 ng
EUR 481

PTPRB Protein Vector (Human) (pPM-C-HA)

PV056815 500 ng
EUR 481

PTPRB Protein Vector (Human) (pPM-C-His)

PV056816 500 ng
EUR 481

PTPRB Protein Vector (Mouse) (pPB-C-His)

PV220942 500 ng
EUR 3296

PTPRB Protein Vector (Mouse) (pPB-N-His)

PV220943 500 ng
EUR 3296

PTPRB Protein Vector (Mouse) (pPM-C-HA)

PV220944 500 ng
EUR 3296

PTPRB Protein Vector (Mouse) (pPM-C-His)

PV220945 500 ng
EUR 3296

Recombinant Human PTPRB Protein, His, Yeast-100ug

QP6556-ye-100ug 100ug
EUR 480

Recombinant Human PTPRB Protein, His, Yeast-10ug

QP6556-ye-10ug 10ug
EUR 236

Recombinant Human PTPRB Protein, His, Yeast-1mg

QP6556-ye-1mg 1mg
EUR 1885

Recombinant Human PTPRB Protein, His, Yeast-200ug

QP6556-ye-200ug 200ug
EUR 744

Recombinant Human PTPRB Protein, His, Yeast-500ug

QP6556-ye-500ug 500ug
EUR 1206

Recombinant Human PTPRB Protein, His, Yeast-50ug

QP6556-ye-50ug 50ug
EUR 299

Ptprb 3'UTR Luciferase Stable Cell Line

TU117286 1.0 ml Ask for price

Ptprb 3'UTR GFP Stable Cell Line

TU167286 1.0 ml Ask for price

PTPRB Rabbit Polyclonal Antibody