PTPRB Rabbit Polyclonal Antibody

PTPRB Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

PTPRB Polyclonal Antibody
ABP60035-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human PTPRB protein at amino acid sequence of 280-360 Applications tips:
Description: A polyclonal antibody for detection of PTPRB from Human. This PTPRB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTPRB protein at amino acid sequence of 280-360

PTPRB Polyclonal Antibody
ES10139-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against PTPRB from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

PTPRB Polyclonal Antibody
ES10139-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against PTPRB from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

PTPRB Antibody
46194-100ul	SAB	100ul	EUR 252

PTPRB Antibody
46194-50ul	SAB	50ul	EUR 187

PTPRB Antibody
DF9841	Affbiotech	200ul	EUR 304
Description: PTPRB Antibody detects endogenous levels of total PTPRB.

PTPRB Antibody
1-CSB-PA019048ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PTPRB. Recognizes PTPRB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

PTPRB Antibody
ABD9841	Lifescience Market	100 ug	EUR 438

Rabbit PTPRB ELISA Kit
ERTP0175	Abclonal	96Tests	EUR 521

Polyclonal PTPRB Antibody (internal region)
AMM07406G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human PTPRB (internal region). This antibody is tested and proven to work in the following applications:

PTPRB Conjugated Antibody
C46194	SAB	100ul	EUR 397

Anti-PTPRB antibody
STJ72286	St John's Laboratory	100 µg	EUR 359

Anti-PTPRB antibody
STJ191297	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to PTPRB

PTPRB siRNA
20-abx930393	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PTPRB siRNA
20-abx930394	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

pOTB7-PTPRB
PVT18153	Lifescience Market	2 ug	EUR 258

PTPRB Blocking Peptide
DF9841-BP	Affbiotech	1mg	EUR 195

PTPRB cloning plasmid
CSB-CL019048HU1-10ug	Cusabio	10ug	EUR 758
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2316 Sequence: atggaggctgaattttacatggtgattcttacctgcttgatcttcaggaactcagaagggtttcagattgtccatgtccagaaacaacagtgtcttttcaaaaatgagaaagtggtcgtgggctcatgcaacaggaccatccagaaccagcagtggatgtggactgaggatgaaa Show more
Description: A cloning plasmid for the PTPRB gene.

PTPRB cloning plasmid
CSB-CL019048HU2-10ug	Cusabio	10ug	EUR 2770
Formulation: 10 μg plasmid + 200μl Glycerol Length: 5994 Sequence: ATGCTGAGCCATGGAGCCGGGTTGGCCTTGTGGATCACACTGAGCCTGCTGCAGACTGGACTGGCGGAGCCAGAGAGATGTAACTTCACCCTGGCGGAGTCCAAGGCCTCCAGCCATTCTGTGTCTATCCAGTGGAGAATTTTGGGCTCACCCTGTAACTTTAGCCTCATCTATA Show more
Description: A cloning plasmid for the PTPRB gene.

pCR4-TOPO-PTPRB
PVT18197	Lifescience Market	2 ug	EUR 383

Protein tyrosine phosphatase receptor type B (PTPRB) polyclonal antibody
ABP-PAB-11037	Allele Biotech	100 ug	Ask for price
Product line: Phosphatases Brand:

Human PTPRB ELISA Kit
EHP0175	Abclonal	96Tests	EUR 521

Bovine PTPRB ELISA Kit
EBP0175	Abclonal	96Tests	EUR 521

Anserini PTPRB ELISA Kit
EAP0175	Abclonal	96Tests	EUR 521

Canine PTPRB ELISA Kit
ECP0175	Abclonal	96Tests	EUR 521

Goat PTPRB ELISA Kit
EGTP0175	Abclonal	96Tests	EUR 521

Human PTPRB ELISA KIT
ELI-16748h	Lifescience Market	96 Tests	EUR 824

Mouse PTPRB shRNA Plasmid
20-abx972300	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human PTPRB shRNA Plasmid
20-abx953909	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Porcine PTPRB ELISA Kit
EPP0175	Abclonal	96Tests	EUR 521

Rat PTPRB ELISA Kit
ERP0175	Abclonal	96Tests	EUR 521

Mouse PTPRB ELISA Kit
EMP0175	Abclonal	96Tests	EUR 521

Mouse Ptprb ELISA KIT
ELI-35907m	Lifescience Market	96 Tests	EUR 865

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Human)
4-PAB048Hu01	Cloud-Clone	EUR 239.00 EUR 2391.00 EUR 598.00 EUR 299.00 EUR 211.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PTPRB (Ala1655~Asp1918) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type B (PTPRB)

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Mouse)
4-PAB048Mu01	Cloud-Clone	EUR 243.00 EUR 2457.00 EUR 613.00 EUR 305.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PTPRB (Gly1214~Val1463) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Protein Tyrosine Phosphatase Receptor Type B (PTPRB)

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Rat)
4-PAB048Ra01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PTPRB (Asn1041~Tyr1310) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Protein Tyrosine Phosphatase Receptor Type B (PTPRB)

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Human), APC
4-PAB048Hu01-APC	Cloud-Clone	EUR 333.00 EUR 3113.00 EUR 872.00 EUR 423.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PTPRB (Ala1655~Asp1918) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with APC.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Human), Biotinylated
4-PAB048Hu01-Biotin	Cloud-Clone	EUR 303.00 EUR 2341.00 EUR 697.00 EUR 369.00 EUR 216.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PTPRB (Ala1655~Asp1918) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with Biotin.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Human), Cy3
4-PAB048Hu01-Cy3	Cloud-Clone	EUR 403.00 EUR 4109.00 EUR 1121.00 EUR 523.00 EUR 245.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PTPRB (Ala1655~Asp1918) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with Cy3.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Human), FITC
4-PAB048Hu01-FITC	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PTPRB (Ala1655~Asp1918) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with FITC.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Human), HRP
4-PAB048Hu01-HRP	Cloud-Clone	EUR 305.00 EUR 2714.00 EUR 772.00 EUR 383.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PTPRB (Ala1655~Asp1918) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with HRP.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Human), PE
4-PAB048Hu01-PE	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PTPRB (Ala1655~Asp1918) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with PE.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Mouse), APC
4-PAB048Mu01-APC	Cloud-Clone	EUR 340.00 EUR 3203.00 EUR 894.00 EUR 432.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PTPRB (Gly1214~Val1463) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with APC.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Mouse), Biotinylated
4-PAB048Mu01-Biotin	Cloud-Clone	EUR 307.00 EUR 2407.00 EUR 714.00 EUR 375.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PTPRB (Gly1214~Val1463) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with Biotin.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Mouse), Cy3
4-PAB048Mu01-Cy3	Cloud-Clone	EUR 411.00 EUR 4229.00 EUR 1151.00 EUR 535.00 EUR 248.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PTPRB (Gly1214~Val1463) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with Cy3.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Mouse), FITC
4-PAB048Mu01-FITC	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PTPRB (Gly1214~Val1463) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with FITC.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Mouse), HRP
4-PAB048Mu01-HRP	Cloud-Clone	EUR 311.00 EUR 2792.00 EUR 791.00 EUR 391.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PTPRB (Gly1214~Val1463) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with HRP.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Mouse), PE
4-PAB048Mu01-PE	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PTPRB (Gly1214~Val1463) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with PE.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Rat), APC
4-PAB048Ra01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PTPRB (Asn1041~Tyr1310) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with APC.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Rat), Biotinylated
4-PAB048Ra01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PTPRB (Asn1041~Tyr1310) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with Biotin.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Rat), Cy3
4-PAB048Ra01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PTPRB (Asn1041~Tyr1310) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with Cy3.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Rat), FITC
4-PAB048Ra01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PTPRB (Asn1041~Tyr1310) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with FITC.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Rat), HRP
4-PAB048Ra01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PTPRB (Asn1041~Tyr1310) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with HRP.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Rat), PE
4-PAB048Ra01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PTPRB (Asn1041~Tyr1310) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with PE.

Guinea Pig PTPRB ELISA Kit
EGP0175	Abclonal	96Tests	EUR 521

PTPRB ORF Vector (Human) (pORF)
ORF014204	ABM	1.0 ug DNA	EUR 354

PTPRB ORF Vector (Human) (pORF)
ORF008408	ABM	1.0 ug DNA	EUR 95

Ptprb ORF Vector (Mouse) (pORF)
ORF055236	ABM	1.0 ug DNA	EUR 1572

Rabbit Protein Tyrosine Phosphatase Receptor Type B (PTPRB) ELISA Kit
abx363023-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Human), APC-Cy7
4-PAB048Hu01-APC-Cy7	Cloud-Clone	EUR 547.00 EUR 6106.00 EUR 1624.00 EUR 727.00 EUR 310.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PTPRB (Ala1655~Asp1918) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with APC-Cy7.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Mouse), APC-Cy7
4-PAB048Mu01-APC-Cy7	Cloud-Clone	EUR 560.00 EUR 6286.00 EUR 1669.00 EUR 745.00 EUR 315.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PTPRB (Gly1214~Val1463) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with APC-Cy7.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Rat), APC-Cy7
4-PAB048Ra01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PTPRB (Asn1041~Tyr1310) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with APC-Cy7.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Antibody
20-abx218060	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Antibody
20-abx104375	Abbexa	EUR 411.00 EUR 133.00 EUR 1149.00 EUR 565.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Antibody
20-abx130068	Abbexa	EUR 314.00 EUR 133.00 EUR 829.00 EUR 439.00 EUR 272.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Antibody
20-abx131514	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Antibody
20-abx320809	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Antibody
abx431909-200ul	Abbexa	200 ul	EUR 286
Shipped within 1-3 working days.

Ptprb sgRNA CRISPR Lentivector set (Mouse)
K4358701	ABM	3 x 1.0 ug	EUR 339

PTPRB sgRNA CRISPR Lentivector set (Human)
K1757401	ABM	3 x 1.0 ug	EUR 339

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Antibody (FITC)
20-abx274236	Abbexa	EUR 467.00 EUR 244.00 EUR 1358.00 EUR 648.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Ptprb sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4358702	ABM	1.0 ug DNA	EUR 154

Ptprb sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4358703	ABM	1.0 ug DNA	EUR 154

Ptprb sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4358704	ABM	1.0 ug DNA	EUR 154

PTPRB sgRNA CRISPR Lentivector (Human) (Target 1)
K1757402	ABM	1.0 ug DNA	EUR 154

PTPRB sgRNA CRISPR Lentivector (Human) (Target 2)
K1757403	ABM	1.0 ug DNA	EUR 154

PTPRB sgRNA CRISPR Lentivector (Human) (Target 3)
K1757404	ABM	1.0 ug DNA	EUR 154

PTPRB Protein Vector (Human) (pPB-C-His)
PV033629	ABM	500 ng	EUR 329

PTPRB Protein Vector (Human) (pPB-N-His)
PV033630	ABM	500 ng	EUR 329

PTPRB Protein Vector (Human) (pPM-C-HA)
PV033631	ABM	500 ng	EUR 329

PTPRB Protein Vector (Human) (pPM-C-His)
PV033632	ABM	500 ng	EUR 329

PTPRB Protein Vector (Human) (pPB-C-His)
PV056813	ABM	500 ng	EUR 481

PTPRB Protein Vector (Human) (pPB-N-His)
PV056814	ABM	500 ng	EUR 481

PTPRB Protein Vector (Human) (pPM-C-HA)
PV056815	ABM	500 ng	EUR 481

PTPRB Protein Vector (Human) (pPM-C-His)
PV056816	ABM	500 ng	EUR 481

PTPRB Protein Vector (Mouse) (pPB-C-His)
PV220942	ABM	500 ng	EUR 3296

PTPRB Protein Vector (Mouse) (pPB-N-His)
PV220943	ABM	500 ng	EUR 3296

PTPRB Protein Vector (Mouse) (pPM-C-HA)
PV220944	ABM	500 ng	EUR 3296

PTPRB Protein Vector (Mouse) (pPM-C-His)
PV220945	ABM	500 ng	EUR 3296

Recombinant Human PTPRB Protein, His, Yeast-100ug
QP6556-ye-100ug	EnQuireBio	100ug	EUR 480

Recombinant Human PTPRB Protein, His, Yeast-10ug
QP6556-ye-10ug	EnQuireBio	10ug	EUR 236

Recombinant Human PTPRB Protein, His, Yeast-1mg
QP6556-ye-1mg	EnQuireBio	1mg	EUR 1885

Recombinant Human PTPRB Protein, His, Yeast-200ug
QP6556-ye-200ug	EnQuireBio	200ug	EUR 744

Recombinant Human PTPRB Protein, His, Yeast-500ug
QP6556-ye-500ug	EnQuireBio	500ug	EUR 1206

Recombinant Human PTPRB Protein, His, Yeast-50ug
QP6556-ye-50ug	EnQuireBio	50ug	EUR 299

Ptprb 3'UTR Luciferase Stable Cell Line
TU117286	ABM	1.0 ml	Ask for price

Ptprb 3'UTR GFP Stable Cell Line
TU167286	ABM	1.0 ml	Ask for price

PTPRB Rabbit Polyclonal Antibody